(PDF) Illuminating NAD+ Metabolism in Live Cells and In Vivo...

来自 : 发布时间：2024-05-10

(PDF) Illuminating NAD+ Metabolism in Live Cells and In Vivo Using a Genetically Encoded Fluorescent Sensor 1 / 54 Illuminating NAD+ Metabolism in Live Cells and In Vivo Using a Genetically Encoded Fluorescent Sensor Yejun Zou1,2,3,11, Aoxue Wang1,2,3,11, Li Huang1,3,11, Xudong Zhu4,11, Qingxun Hu1,3,11, Yinan Zhang5, Xianjun Chen1,3, Fengwen Li5, Qiaohui Wang1, 3, Hu Wang6, Renmei Liu1, 3, Fangting Zuo1, 3, Ting Li1, 3, Jing Yao1, 3, Yajie Qian1, 3, Mei Shi1,3, Xiao Yue1,3, Weicai Chen1,3, Zhuo Zhang1, 3, Congrong Wang7, Yong Zhou8, Linyong Zhu1,9, Zhenyu Ju6, Joseph Loscalzo10, Yi Yang1,2*, Yuzheng Zhao1,3,12* 1Optogenetics Synthetic Biology Interdisciplinary Research Center, State Key Laboratory of Bioreactor Engineering, Shanghai Collaborative Innovation Center for Biomanufacturing Technology, Research Unit of Chinese Academy of Medical Sciences, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237, China 2CAS Center for Excellence in Brain Science, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237, China 4Institute of Ageing Research, School of Medicine, Hangzhou Normal University, 1378 Wenyixi Road, Hangzhou 311121, China 5The Metabolic Diseases Biobank, Shanghai Key Laboratory of Diabetes Mellitus, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai 200233, China 6Key Laboratory of Regenerative Medicine of Ministry of Education, Guangzhou Regenerative Medicine and Health Guangdong Laboratory, Institute of Aging and Regenerative Medicine, Jinan University, Guangzhou 510632, China 7Translational Medical Center for Stem Cell Therapy, Department of Endocrinology and Metabolic Disease, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, China 2 / 54 8School of Ophthalmology and Optometry and Eye Hospital, Wenzhou Medical University, 270 Xueyuan Road, Wenzhou, Zhejiang 325027, China 9School of Chemistry and Molecular Engineering, East China University of Science and Technology, 130 Mei Long Road, Shanghai 200237, China 10Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA 11These authors contributed equally to this work 12Lead Contact Correspondence: Y.Y. (yiyang@ecust.edu.cn) and Y. Zhao (yuzhengzhao@ecust.edu.cn) 3 / 54 SUMMARY Understanding of NAD+ metabolism provides many critical insights into health and diseases; yet highly sensitive and specific detection of NAD+ metabolism in live cells and in vivo remains difficult. Here we present ratiometric, highly responsive genetically encoded fluorescent indicators, FiNad, for monitoring NAD+ dynamics in living cells and animals. FiNad sensors cover physiologically relevant NAD+ concentrations and sensitively respond to increases and decreases in NAD+. Utilizing FiNad, we performed a head-to-head comparison study of common NAD+ precursors in various organisms and mapped their biochemical roles in enhancing NAD+ levels. Moreover, we showed that increased NAD+ synthesis controls morphofunctional changes of activated macrophages, and directly imaged NAD+ declines during aging in situ. The broad utility of the FiNad sensors will expand our mechanistic understanding of numerous NAD+-associated physiological and pathological processes, and facilitate screening for drug or gene candidates that affect uptake, efflux, and metabolism of this important cofactor. 4 / 54 INTRODUCTION Nicotinamide adenine dinucleotide (NAD+) and its reduced form NADH are key coenzymes for redox reactions and play central roles in energy metabolism(Verdin, 2015; Zhao et al., 2018). NAD+ is also a co-substrate of many regulatory enzymes, such as sirtuins (SIRTs), poly (ADP-ribose) polymerases (PARPs), and the cyclic ADP-ribose synthases (CD38 and CD157); and participates in a wide range of cellular processes(Canto et al., 2015; Rajman et al., 2018). Its levels are often altered in aging(Bonkowski and Sinclair, 2016; Imai and Guarente, 2014; Verdin, 2014), neurodegeneration(Verdin, 2015), kidney injury(Poyan Mehr et al., 2018), obesity(Canto et al., 2012), diabetes(Yoshino et al., 2011), adipogenesis(Ryu et al., 2018), cancer(Tateishi et al., 2015), and congenital malformations(Vander Heiden, 2017). In eukaryotic cells, the NAD+-synthesizing and NAD+-consuming enzymes are highly compartmentalized(Canto et al., 2015). For many years, the weak endogenous fluorescence of NADH has been used in studies of mitochondrial metabolic states; however, NAD+ lacks the intrinsic fluorescence, which hinders its direct imaging in living cells and in vivo. Traditional biochemical methods, such as enzymatic cycling assays, chromatography, and mass spectrometry, require cell lysis, making it challenging to obtain spatiotemporal information about NAD+ functions in single living cells and in vivo. A genetically encoded fluorescent sensor for measuring NAD+ was previously reported by fusing a bacterial NAD+-binding DNA ligase (LigA) to cpVenus (abbreviated as LigA-cpVenus)(Cambronne et al., 2016). Although LigA-cpVenus represented a significant step forward for live cell NAD+ imaging, its dynamic response and specificity appeared to be limited. Very recently, a semisynthetic NAD+ indicator, denoted NAD-Snifit, was shown to 5 / 54 have a large dynamic response in vitro(Sallin et al., 2018). NAD-Snifit, however, has no intrinsic fluorescence and requires exogenous dyes for labelling. Thus, the excess of dyes have to be removed by a multiple washing procedure and lengthy incubation, which is not only time intensive but also may render the analysis susceptible to artifacts. Considering the vital role that NAD+ metabolism plays in health and disease, a genetically encoded NAD+ sensor of superior performance remains to be developed. Previously, we and others developed genetically encoded NADH sensors for monitoring the NADH/NAD+ redox state at subcellular resolution (Bilan et al., 2014; Hung et al., 2011; Zhao et al., 2015; Zhao et al., 2011). Among them, the SoNar sensor is unique as its fluorescence also markedly responds to the binding of NAD+; however, SoNar reports the NADH/NAD+ ratio rather than the absolute concentrations of the two nucleotides intracellularly. Herein, we report the development of a highly responsive, ratiometric, genetically encoded NAD+ sensor, denoted FiNad (fluorescent indicator of NAD+/AXP ratio), where AXP is the total pool of ATP and ADP. FiNad allows rapid, sensitive, specific, and real-time read-out of NAD+ dynamics in various organisms, thereby providing a powerful tool for NAD+ detection and bioimaging. DESIGN Circular permuted fluorescent proteins (cpFPs) have been utilized for the development of genetically encoded fluorescent sensors to monitor cellular metabolites. In these cpFPs, the original N- and C-termini are joined with a short peptide linker, and new N- and C-termini are created around the fluorophore of cpFPs, making its fluorescence highly sensitive to changes 6 / 54 in metabolite levels. In our previous study (Zhao et al., 2015), cpYFP was inserted between amino acids residues located on surface loops of Rex protein from Thermus aquaticus (T-Rex). Among them, the chimera with cpYFP inserted after Phe189 of T-Rex showed significantly higher responses upon NADH binding or NAD+ binding than other chimeras (Zhao et al., 2015). To develop an NAD+ specific sensor, we then created a library of constructs with randomized linkers of 1-3 amino acid residues between T-Rex and cpYFP in the F189/L190 chimera, and selected for the variants not only with enhanced dynamic response to NAD+ and but also with reduced affinity toward NADH (Figures S1A and S1B). This library of variants was expressed in E. coli on solid media, and clones that exhibited bright green fluorescence were picked. Chimera variants expressed in these clones were then assayed for their fluorescence response to NAD+ and NADH, respectively (Figure S1A). Among more than 500 clones, we identified one variant exhibited the most dramatic increase in fluorescence excited at 485 nm upon NAD+ addition (Figure S1C). This variant, termed FiNad, was sequenced (Figure S1B; Table S1) and further characterized. As a genetically encoded sensor, FiNad can be easily introduced into cells, organelles, or organisms of interest by transfection, infection, or electroporation. In comparison, it would be very challenging to apply semisynthetic sensors such as NAD-Snifit(Sallin et al., 2018) for in vivo studies in animals, as it is difficult to remove unbound extraneous dyes, which lead to significant interference (the dye itself strong fluorescence). We, therefore, reasoned that FiNad might be a very useful reagent with which to monitor NAD+ fluctuations in live cells and in vivo. RESULTS 7 / 54 A highly responsive genetically encoded NAD+/AXP ratio sensor FiNad sensor was created by inserting cpYFP between residues 189 and 190 of the T-Rex monomer using short polypeptide linkers, Gly and Gly-Thr-Gly (Figures 1A and S1B), and manifested a dramatic dynamic range, i.e. 7-fold increase in fluorescence (F/F) when excited at 485 nm in the presence of NAD+ (Figures 1B and S1C). FiNad’s fluorescence responded to NADH similarly, but not to other adenine nucleotides, such as NADP+, NADPH, ATP, or ADP (Figure S1D). Nevertheless and interestingly, we found that ATP or ADP, the adenine nucleotides most highly abundant in the cells, competes with the binding of NAD+ to FiNad, shifting the apparent Kd of FiNad for NAD+ from ~14 μM to ~1.3 mM (Figure S1E), which falls in the range of physiological NAD+ levels (Figure 1C). The competition between NAD+ and AXP is not surprising, as ADP is an intrinsic moiety of NAD+. In the presence of physiological adenine nucleotide concentrations, the Kd of FiNad for NADH shifted from ~1.5 μM to ~100 μM, which is far above cytosolic/nuclear free NADH concentration (0.1-1 μM)(Zhang et al., 2002; Zhao et al., 2011) (Figures 1C and S1D). Considering that cytosolic/nuclear NAD+/NADH ratio typically ranges from 100 to 1000(Zhao et al., 2016), thus, FiNad should respond to the intracellular NAD+ concentration, but not to the NAD+/NADH ratio in cytosol or nucleus of the cells (Figure 1D). According to this competitive scheme, FiNad’s steady-state fluorescence response should report the NAD+/AXP ratio rather than the absolute concentrations of these nucleotides (Figures 1E and S1F-S1J). Like ATP or ADP, AMP has similar competitive effect on NAD+ binding (Figure S1K); however, intracellular AMP concentration is two orders of magnitude less than the total pool of ATP and ADP(Park et al., 2016). Thus, its effect on the response of FiNad would be minimal within cells. Furthermore, 8 / 54 our data show that FiNad’s response to NAD+ was not affected by NADP+, NADPH, and various ATP/ADP ratios, which determine the energy charge of the cell (Figures S1L and S1M). Considering that the total physiological pool of adenine nucleotides are usually maintained in homeostasis(Carling et al., 2011; Hardie et al., 2012), we surmised that the FiNad sensor actually reports intracellular NAD+ fluctuations. For dual color ratiometric imaging, we fused FiNad with mCherry, a red fluorescent protein (Figure 1A). mCherry-FiNad responded to NAD+ very similarly to FiNad, suggesting the mCherry fusion did not interfere with FiNad’s NAD+ sensing function (Figure S1N). Therefore, the green/red fluorescence ratio of mCherry-FiNad can be used to report NAD+ dynamics specifically, unaffected by the sensor’s concentration. Further studies showed that the mCherry-FiNad sensor had high selectivity toward NAD+, without any apparent fluorescence changes toward or in the presence of NAD+ precursors such as nicotinic acid (NA), nicotinamide (NAM), nicotinamide mononucleotide (NMN), and nicotinamide riboside (NR) (Figures 1F, S1O, and S1P). In comparison, the LigA-cpVenus NAD+ sensor showed significant non-specificity, as it responded to two frequently used NAD+ precursors, NMN and NR, with affinity similar to that of NAD+ (Figure S1Q). As a result, the response of LigA-cpVenus to NAD+ was diminished in the presence of 0.5-5 mM NMN or NR (Figures S1R and S1S), the pharmacological concentrations widely used in studies of intracellular NAD+ metabolism (Ryu et al., 2018; Yoshino et al., 2018). As other cpFP-based sensors(Tao et al., 2017; Zhao et al., 2015; Zhao et al., 2011), mCherry-FiNad’s green fluorescence excited at 485 nm is sensitive to pH (Figure S1T), but its dynamic range, Kd, and red fluorescence excited at 590 nm are comparatively pH resistant 9 / 54 (Figures S1T-S1V). When pH fluctuations do occur, the pH effects can be corrected by measuring mCherry-FiNad’s and mCherry-cpYFP’s fluorescence in parallel, owing to their very similar pH responses (Figure S1W). In addition, FiNad’s fluorescence is not significantly affected by temperature fluctuations between 20 °C and 40 °C (Figure S1X). Taken together, these data show that FiNad sensor displays excellent sensitivity, selectivity and a large dynamic range, which makes it a promising tool for live cell and in vivo NAD+ studies. Imaging NAD+ metabolism in living bacteria To assess the suitability of mCherry-FiNad in living bacteria, we expressed the sensor in the cytoplasm of E. coli BL21 (DE3) cells. FiNad manifested significant changes of its fluorescence when cellular NAD+ levels increased upon extraneous NAD+ precursor supplementation (e.g., NMN and NR), or when NAD+ levels decreased by nicotinic acid phosphoribosyltransferase (pncB) inhibitor, 2-hydroxynicotinic acid (2-HNA), treatment (Figures 2A and 2B). These data are consistent with the results of biochemical analysis of cellular NAD+ content (Figure S2A), and cellular AXP pool showed minimal changes (Figure S2B). In contrast, the LigA-cpVenus sensor showed minimal responses when cells were treated with NA, NAM, NMN, NR, or 2-HNA (Figures S2C and S2D). FiNad’s fluorescence can be monitored by flow cytometry analysis or confocal microscopy (Figures 2C-2F). As the control, mCherry-cpYFP’s fluorescence did not significantly change upon NAD+ precursors or 2-HNA treatment (Figures 2F, S2E, and S2F). These data excluded the possibility of interference by pH variations. FiNad sensor reports NAD+ metabolism in living cells and in vivo 10 / 54 When stably expressed in human embryonic kidney 293 cells, the mCherry-FiNad sensor showed bright fluorescence and was mostly localized in the cytosol (Figure S3A). Agents that significantly affected SoNar fluorescence and cellular NADH/NAD+ redox states, e.g., the mitochondrial complex I inhibitor rotenone or pyruvate (Figure S3B), did not significantly alter FiNad’s fluorescence, consistent with our previous reports that these agents cause ratio fluctuation in cells, and that cellular NAD+ levels largely remain constant under these treatment conditions(Zhao et al., 2015; Zhao et al., 2016). When cells were treated with rotenone and oligomycin simultaneously, the fluorescence of PercevalHR, an ADP/ATP ratio biosensor, increased significantly (Figure S3C), suggesting an increase of cellular ADP/ATP ratio(Tantama et al., 2013); by contrast, mCherry-FiNad’s fluorescence remained constant. These data suggest that mCherry-FiNad is not sensitive to changes in intracellular ADP/ATP ratio or NADH/NAD+ ratio. In mammalian cells, NAD+ is synthesized predominantly through the NAMPT-dependent salvage pathway(Canto et al., 2015). [For reference, we attach a diagram that explains the central nodes for cellular NAD+ metabolism in this study (Figure 3A).] We found that mCherry-FiNad correctly reported the decrease of cytosolic NAD+ level when NAMPT was inhibited by the pharmacological inhibitor, FK866, as indicated by the decrease of mCherry-FiNad green/red fluorescence ratio and cellular NAD+ pool (Figures 3B-3D, and S3D-S3F), whereas cellular AXP pool showed minimal changes (Figure S3F). Conversely, mCherry-FiNad’s fluorescence increased upon inhibition of three known NAD+-consuming enzymes concomitant with the expected increase in cellular NAD+ (Figures 3D-3F). Among them, inhibition of PARP1/2 (inhibitors, AZD2281 and AZD2461) was most effective at 11 / 54 increasing cellular NAD+ level, followed by inhibition of CD38 (inhibitor, apigenin) and inhibition of SIRT1 (inhibitor, EX527) (Figures 3D-3F), suggesting PARPs are the major cellular NAD+ consumer in these cells. Interestingly, we also found that metformin, a drug used to treat type 2 diabetes mellitus (and possibly lifespan extension in some systems), induced a dose-dependent NAD+ increase (Figure 3G). In contrast, cells expressing mCherry-cpYFP instead of mCherry-FiNad showed no obvious fluorescence changes after metformin treatment, thereby excluding the pH effects (Figure 3G). FiNad was also able to report the rapid drop of cytosolic NAD+ levels during PARP1 activation by MNNG in living cells, ex vivo muscle tissues and live mice (Figures 3H-3J, and S3G-S3J). Consistent with this FiNad-based measurement, the measurement of the total NAD+ pool in cell lysates by a biochemical assay also showed that the cellular NAD+ level increased after PARP1/2, CD38, SIRT1 inhibition, or metformin treatment, and decreased with NAMPT inhibition or PARP activation, whereas cellular AXP pool showed minimal changes (Figures S3K-S3M). Only high concentrations of MNNG, the PARP activator, caused marked decrease of cellular AXP pool (Figure S3H), which was consistent with previous reports as massive ADP ribosylation reaction depleted AXP pool(Zong et al., 2004). Even under such extreme conditions, however, the decrease of NAD+ levels is still more significant than that of AXP levels, and FiNad correctly reported the decrease of the NAD+/AXP ratio. Collectively, these data suggest that cellular NAD+ is more sensitive to cellular activities and environmental changes, while adenine nucleotides have a strong tendency to maintain physiological homeostasis. We further expressed the FiNad sensor in the nucleus by tagging it with organelle-specific signal peptides (Figure S3A). The nuclear NAD+ level in resting cells or cells treated with PARP1/2 inhibitor was similar to that of 12 / 54 cytosol (Figures S3A, S3N and S3O), as NAD+ diffuses freely between these two compartments. These data demonstrate the specific role of PARP1/2, CD38, SIRT1, and NAMPT as viable therapeutic targets for modulating NAD+ metabolism. Mapping the different roles of NAD+ precursors in boosting NAD+ levels in various organisms The administration of NAD+ precursors has long been known to promote a variety of beneficial effects in cells; however, how different NAD+ precursors are metabolized and regulated to protect cells remains unclear in mammalian cells (Figure 3A). As shown by FiNad’s fluorescence, NAD+ precursors such as NAM, NMN, and NR effectively increased cytosolic NAD+ levels (Figures 4A, 4B, S4A, and S4B), consistent with the results of biochemical analysis of cellular NAD+ content (Figure S4C), while cellular AXP levels remained constant (Figure S4D). Interestingly, NAD+ precursors such as NAM, NMN, and NR also reversed NAMPT inhibition-triggered NAD+ deficiency and cell death (Figures 4C, 4D, and S4E). The NAD+ precursor NA was much less effective at enhancing cytosolic NAD+ levels in resting HEK293 cells; however, NA was able to replenish cytosolic NAD+ levels in NAMPT-inhibited cells, and partially protected the cells from death (Figures 4E and 4F). These data suggest that the Preiss-Handler pathway for NAD+-synthesis from NA may be activated upon inhibition of the NAMPT-dependent salvage pathway. Interestingly, NA-mediated replenishment of the NAD+ level and improvement of cell survival in NAMPT-inhibited cells only occurred at low NA concentrations; higher concentrations of NA, e.g., 2 mM, failed to replenish the NAD+ level or protect the cells from death (Figures 4D-4F, 13 / 54 and S4E). The explanation for this biphasic dose-dependent effect of NA in the presence of NAMPT inhibition on NAD+ (partial) restoration remains to be investigated. To assess further the in vivo efficacy of four precursors in increasing NAD+ levels, we transferred a vector encoding mCherry-FiNad into mouse muscle tissues via electroporation. The following day, mice at 8 weeks of age were given intraperitoneal injections of vehicle control, NA, NAM, NMN, or NR (500 mg per kg daily) for 6 days. Notably, NAM, NMN, and NR treatment resulted in a significant NAD+ increase in muscle tissues compared with controls or NA treatment (Figures 4G-4I), consistent with the results of biochemical analysis of cellular NAD+ content (Figure S4F), while cellular AXP level remain constant (Figure S4G). As a control, minimal changes in fluorescence were observed in mCherry-cpYFP-expressing muscle tissues (Figures 4H and 4I). We further microinjected mCherry-FiNad sensor into the animal pole of zebrafish embryos and cultivated the embryos for ~30 h. Individual zebrafish were next exposed to NAD+ precursors for an additional ~24 h, and then narcotized for in vivo imaging. Upon NAM supplementation, we observed a dose-dependent increase in NAD+ level, as shown by mCherry-FiNad’s fluorescence ratio signal (Figures 4J and 4K); however, the other three NAD+ precursors, i.e., NA, NMN, and NR, were not able to boost NAD+ levels (Figures 4K and 4L). NAMPT inhibition with FK866 treatment induced a marked decrease in NAD+ level at both 28 h and 54 h post-fertilization in zebrafish (Figures 4K, 4M, S4H and S4I). These data suggest that the NAM-NAMPT axis accounts for NAD+ biosynthesis in zebrafish. As a control, minimal changes in fluorescence were observed in mCherry-cpYFP-expressing zebrafish with NAD+ precursors or FK866 treatment (Figures 4J, 4L-4N, and S4J). Consistent with this FiNad-based measurement, biochemical analysis also showed that total NAD+ level 14 / 54 increased after NAM supplementation, and decreased with NAMPT inhibition (FK866), whereas cellular AXP pool showed minimal changes in zebrafish (Figures S4K and S4L). Taken together, we utilizing FiNad have performed a head-to-head comparison study of four common NAD+ precursors in various organisms and mapped their roles in enhancing NAD+ levels shown as a heatmap (Figure 4O). Increased synthesis of NAD+ controls morphofunctional changes in activated macrophages Macrophages function as ‘pathogen sensors,’ and are critical participants in inflammation and aging (Plowden et al., 2004; Solana et al., 2006). The bioenergetic demands of different macrophage populations have been studied extensively (Ghesquiere et al., 2014); however, much less is known about the relationship between macrophage activation and cellular NAD+ metabolism. Macrophage activation induced by lipopolysaccharide (LPS) and interferon-γ (IFN-γ) modestly increased cytosolic NAD+ level as shown by the fluorescence ratio of mCherry-FiNad (Figures 5A, 5B, S5A-S5C), consistent with the results of biochemical analysis (Figures S5D and S5E). To investigate the cause of the NAD+ increase, we studied enzymes associated with NAD+ synthesis (e.g., NAMPT, NMNAT2) and/or NAD+ consumption (e.g., PARP1, CD38, and SIRT1/2) by Western blotting. Among them, only NAMPT protein was elevated (~1-fold) in activated macrophages (Figure 5C). Treatment with specific NAMPT inhibitors, FK866 or STF118804, suppressed LPS/IFN-γ-stimulated glycolysis as shown by changes in the cytosolic NADH/NAD+ ratio (Figures 5D, 5E, and S5F-S5H) and lactate excretion (Figure 5F); nitric oxide (NO) production as shown by DAF-FM DA fluorescence 15 / 54 (Figures 5G and 5H); production of the proinflammatory cytokines, interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNFα) (Figures 5I and 5J); and phagocytosis efficiency (Figures 5K and 5L). Collectively, these observations suggest that a global link exists between NAMPT-mediated NAD+ synthesis and macrophage activation. We then study effects of macrophage activation on NADPH using the NADPH sensor iNap1(Tao et al., 2017). LPS/IFN-γ treatment induced a significant decrease of NADPH levels in the cells (Figures S5I and S5J), particularly under glucose-deprived conditions (Figures S5K and S5L), which were consistent with our previous reports (Tao et al., 2017). To investigate the cause of the NADPH level changes, we studied the major enzymes associated with NADPH consumption (e.g., iNOS, FASN, GSR) and/or NADPH synthesis (e.g., G6PD, PGD, MTHFD1, ME1, and IDH1) by Western blotting. Among them, only iNOS protein was significantly induced in activated macrophages (Figure S5M). Treatment with a known iNOS inhibitor, L-NAME(Wang et al., 2015), suppressed LPS/IFN-γ-induced cytosolic NADPH decrease (Figures S5J and S5L), and nitric oxide production (Figures S5N and S5O); however, iNOS inhibition had minimal effects on the physiological function of activated macrophages, such as production of the proinflammatory cytokines (e.g., TNFα) (Figure S5P) and phagocytosis efficiency (Figure S5Q). These data are consistent with previous reports that macrophages synthesize nitric oxide via iNOS and consume NADPH upon activation (Noda and Amano, 1997). To clarify, a working model is provided in Figure 5M, showing that increased synthesis of NAD+ controls the morphofunctional changes of activated macrophages and upregulation of iNOS is associated with increased NO production and NADPH consumption. 16 / 54 Imaging NAD+ decline in cell senescence, in the aging mouse, and in human urine-derived stem cells at different ages An increasing number of studies have shown that cellular NAD+ levels decline with age, and the deterioration of NAD+ metabolism promotes aging-associated diseases(Bonkowski and Sinclair, 2016; Verdin, 2015). To assess NAD+ dynamics during aging in situ, we applied the mCherry-FiNad sensor to four typical models of aging research, including replicative senescence of human fibroblasts, naturally aged mice, aged telomerase-deficient mice, and human urine-derived stem cells at different ages. Human diploid fibroblasts are widely used as a model system for cell senescence(Kraya et al., 2017). Indeed, human fibroblasts CCC-HPF-1 at passage 30 have a higher percentage of senescence-associated β-galactosidase (SA-β-Gal, a gold-standard marker of senescent cells) (Figures 6A and 6B) and lower NAD+ level, as shown by mCherry-FiNad’s fluorescence (Figures 6C and 6D) compared to passage 20. mCherry-FiNad fluorescence imaging also revealed the decrease of NAD+ levels in both myoblasts and cardiomyocytes freshly isolated from aged mice (~24 months), compared to that from young mice (~2 months) (Figures 6E-6I). To visualize NAD+ level in muscle tissues, we transferred mCherry-FiNad cDNA by electroporation into muscle of 10-month-old WT or the third generation of telomerase-deficient (G3Terc-/-, G3) mice (Figure 6J), which were characterized by PCR (Figure S6A) and have shown prominent premature aging symptoms as reported previously (Sahin et al., 2011). The mCherry-FiNad sensors expressed well in muscle tissue of these mice, and their fluorescence was visible 5 days after electroporation. There was a marked decrease of NAD+ level in muscle tissues of G3 mice compared to that of the WT mice, as shown by mCherry-FiNad’s fluorescence (Figures 6K and 6L). No obvious change 17 / 54 in fluorescence was observed in mCherry-cpYFP-expressing muscle tissues (Figures 6K and 6L). Intriguingly, we also observed a remarkable decrease of NAD+ levels in myoblasts freshly isolated from G3 mice compared with that from WT mice (Figures 6M and 6N), suggesting that there is a direct connection between NAD+ decline and telomere attrition-driven aging. We isolated urine-derived stem cells (hUSC) (Zhou et al., 2012) from healthy young (24-27 years) and middle-aged (40-56 years) men to assess further age-related changes in NAD+ levels (Figure 6O). mCherry-FiNad fluorescence imaging showed a decrease of NAD+ levels in hUSC from middle-aged adults, compared to that from young adults (Figures 6P and 6Q). As a control, minimal changes in fluorescence were observed in mCherry-cpYFP-expressing hUSC at different ages (Figures S6B and S6C). We also measured AXP and NAD+ levels during aging by biochemical assays. The data showed that cellular AXP pool slightly decreased during aging, however, the decrease of NAD+ levels were much more significant (Figures S6D-S6K). Therefore, FiNad correctly reported the decrease of the NAD+/AXP ratio, based on four typical models of aging research. DISCUSSION Investigators have long explored the metabolic roles of NAD+ and AXP, which are important metabolic mediators. There also exists a close structural and functional link between NAD+ and adenine nucleotides. NAD+ itself is an adenine nucleotide, as ADP is an intrinsic moiety of NAD+ that is incorporated during its synthesis at the expense of ATP. Furthermore, of course, NAD+ and its reduced form (NADH) are necessary cofactors for many metabolic reactions, such as glycolysis, the tricarboxylic acid cycle, and fatty acid β-oxidation, and the 18 / 54 conversion between them drives the production of ATP via anaerobic glycolysis and mitochondrial oxidative phosphorylation(Fang et al., 2017). Several studies have also shown that millimolar ATP could inhibit the activity of NAD+-substrate enzymes, such as SIRT1(Kang et al., 2017), PARP(Toledano et al., 2012), and CD38(Takasawa et al., 1993). In addition, AXP competes the binding of NAD+ to the NAD+/NADH sensing transcription factors such as Rex(Wang et al., 2008) or NadR(Grose et al., 2005). These reports suggested that the activities of these important enzymes and transcription factors might be determined actually by the NAD+/AXP ratio, but not the NAD+ level. Thus, FiNad sensor provides a unique yet powerful tool for investigating the role of the NAD+/AXP ratio, which may be more physiologically or pathophysiologically relevant as a key metabolic indicator or regulator of energy metabolism. In practice, the total physiological pool of adenine nucleotides is usually maintained homeostatically for proper functioning of organisms(Carling et al., 2011; Hardie et al., 2012). Consistently, we found that cellular AXP pool showed minimal changes after PARP1/2, CD38, or SIRT1 inhibition, NAD+ synthesis inhibition or boosting. Thus, changes in FiNad sensor fluorescence actually reflect intracellular NAD+ fluctuations under these circumstances. As expected, the FiNad sensor responds well to increases or decreases of NAD+ in different contexts, such as extraneous NAD+ precursor supplementation, drug treatment, modulation of NAD+-synthesis or consumption, macrophage activation or aging, consistent with the biochemical analysis of cellular NAD+ content. The previously reported genetically encoded NAD+ sensor, LigA-cpVenus(Cambronne et al., 2016), seems to have significant non-specific responses to NMN and NR, the two NAD+ precursors that are frequently used to replenish 19 / 54 NAD+ pools and to improve health or life span in many studies, and does not respond to NAD+ fluctuation in cells treated with pharmaceutical concentrations of these precursors, as shown in previous work(Cambronne et al., 2016; Ryu et al., 2018), as well as by our data. Such non-specificity may complicate live-cell or in vivo studies in NAD+ metabolism. By contrast, FiNad shows high specificity for NAD+ without response to NAD+ analogs or precursors. FiNad also displays a much improved dynamic range in vitro (7 folds over that of LigA-cpVenus), making it useful for tracking subtle differences in NAD+ metabolism (Table S2). Currently, FiNad is the only sensor that permits sensitive, specific, and real-time readout of NAD+ metabolism in vivo across different organisms. We therefore strongly believe FiNad sensor is a significant step toward resolving the biological function of NAD+. Administration of NAD+ precursors has long been known to promote beneficial effects, including improving metabolic dysfunction, slowing the aging process, and protecting against certain metabolic diseases (e.g., obesity, diabetes mellitus, and neurodegeneration), prompting numerous clinical trials of NAD+ boosters in humans(Rajman et al., 2018). Our head-to-head comparison in vivo study to evaluate the efficacy of NAD+ precursors (Table S3) showed that NMN and NR appear rather effective in bacteria, mammalian cells, and mice, while NAM was more effective in vertebrate cells, zebrafish, and mice than in bacteria as means to increase NAD+. Especially, the NAM-NAMPT axis mainly accounts for NAD+ biosynthesis in zebrafish. It is well known that NAD+ boosters like NMN and NR can extend lifespan. NAM can be as effective as NMN or NR at enhancing NAD+ levels in mammalian cells as our data shown; however, it is intriguing that NAM supplementation has little effect on extending lifespan(Mitchell et al., 2018). We found that NMN and NR also efficiently enhance 20 / 54 NAD+ level in bacteria, whereas NAM only slightly does so. Future studies might be needed to investigate whether NAD+ enhancement in gut microflora is also vital for extending lifespan, considering the importance of gut microflora in many aspects of human health. Surprisingly, NA is essentially ineffective at augmenting NAD+ in resting bacteria, mammalian cells, zebrafish, and mice; however, NA may help to replenish the NAD+ pool through the Preiss-Handler pathway when activated during inhibition of the NAMPT-dependent salvage pathway. Interestingly, NA works only at a low dosage in these conditions. Innate and adaptive immunity undergoes severe deterioration with age, leading to increased susceptibility to infection and aging-related diseases (Solana et al., 2006). Macrophages play an important role in inflammatory responses, elimination of pathogens, and tissue repair. Utilizing FiNad, we show that the increase of NAD+ synthesis via the NAMPT-dependent salvage pathway is important for classical M1 activation of macrophages, including metabolic reprogramming, production of proinflammatory cytokines, and phagocytosis efficiency. Emerging evidence suggests that metabolic changes also play vital roles in the development and function of other types of immune cells, such as T lymphocytes(Tyrakis et al., 2016), B lymphocytes(Chan et al., 2017), and mast cells(Misto et al., 2019). It has become clear that NAD+ levels steadily decline with age for all species, from yeast to humans; however, all of these reports are based on the enzymatic cycling assay, liquid chromatography, or mass spectroscopy assays, which require cell lysis. By using FiNad, we provide the evidence showing a direct demonstration of NAD+ decline during aging in situ, including replicative senescence, natural aging, telomerase deficient-derived 21 / 54 premature aging, and age-related stem cell aging. The ability to map NAD+ metabolism with the FiNad sensor is critical to the interrogation of NAD+’s roles in biologically and medically important processes, and in the ongoing search for NAD+-enhancing compounds, which may have important therapeutic or clinical implications. Given the significance and close link of NAD+/NADH and NADP+/NADPH and the current family of specific sensors for live cell/organism studies, investigators currently have the means available to develop a live-cell redox metabolism atlas using FiNad, Frex(Zhao et al., 2011), SoNar(Zhao et al., 2015), Apollo-NADP+(Cameron et al., 2016), and iNap sensors(Tao et al., 2017; Zou et al., 2018). Such an integrative approach would reveal the key determinants of redox currency in organisms. Limitations It should be noted that the FiNad, as an NAD+/AXP ratio sensor, does not directly provide quantitative information on total NAD+ concentration in the cells. When physiological pool of adenine nucleotides is maintained in homeostasis, FiNad can be used to measure free NAD+ dynamics. However, when there are global or localized changes of AXP, it may interfere with such free NAD+ measurement using FiNad sensor. Under such circumstances, free NAD+ levels may be calculated with the quantitative information of the total adenine nucleotide pool. We are currently developing genetically encoded sensors for total adenine nucleotide measurement. Once obtained, these sensors may be used together with the FiNad sensor, for the measuring of NAD+, AXP, and their ratios simultaneously in live cells. As a genetically encoded fluorescent sensor, FiNad may be targeted to different subcellular 22 / 54 compartments. However, since FiNad also binds with NADH, the sensor might not accurately measure NAD+ across all possible concentrations of NADH in subcellular compartments. For the cytosol/nucleus, free NADH concentration is 0.1-1 μM (Zhang et al., 2002; Zhao et al., 2011; Zhao et al., 2016), far below the apparent Kd of FiNad for NADH (~100 μM) in the presence of physiological adenine nucleotides concentrations. Therefore, it is unlikely that cytosolic/nuclear free NADH fluctuations would interfere with NAD+/AXP ratio measurement. Nevertheless, it would be challenging to use FiNad for tracing NAD+ dynamics in mitochondria, where FiNad’s response may be interfered by the high concentrations of free NADH (dozens of μM or even higher)(Joubert et al., 2004; Zhao et al., 2011). Therefore, a highly responsive, mitochondrial targeting NAD+ sensor is still desirable for such studies. 23 / 54 ACKNOWLEDGMENTS We thank Gary Yellen for the PercevalHR vector; Fei Wang, Ping Hu, Yimin Lao, Jing Yi, Chiqi Chen, Junke Zheng, Peili Ni, Yunbin Zhang, Yihong Wang, Xie Li for technical assistance; and Stephanie C. Tribuna for secretarial assistance. This research is supported by National Key Research and Development Program of China (2017YFA050400, 2019YFA0904800), NSFC (91649123, 91857202, 31722033, 31671484, 21937004, 91749203, 81525010, 81420108017), the Shanghai Science and Technology Commission (18JC1411900, 16430723100, 19YF1411400, 19YF1411300), Research Unit of New Techniques for Live-cell Metabolic Imaging(Chinese Academy of Medical Sciences, 2019RU01), Major Program of Development Fund for Shanghai Zhangjiang National Innovation Demonstration Zone(Stem Cell Strategic Biobank and Stem Cell Clinical Technology Transformation Platform, ZJ2018-ZD-004), Innovative research team of high-level local universities in Shanghai, Young Elite Scientists Sponsorship Program by Cast, Shanghai Young Top-notch Talent, the State Key Laboratory of Bioreactor Engineering, the Fundamental Research Funds for the Central Universities, the China Postdoctoral Science Foundation (2019M651413), and US National Institutes of Health (HL061795, HG007690, and GM107618), and the American Heart Association (D700382). AUTHOR CONTRIBUTIONS Y. Zhao, Y.Y., Z.J., Y.Zou, A.W., L.H., Q.H., and X.Z. designed the experiments and interpreted results. L.H., Q.H., and X.C. carried out the molecular cloning, screening and in vitro characterization. Y. Zou, A.W., L.H., X.Z., Y.Zhang, F.L., and Q.W. carried out live cell research and imaging. H.W., R.L., F.Z., T.L., J.Y., Y.Q., M.S., X.Y., W.C., Z.Z., C.W., Y.Zhou, and L.Z. gave 24 / 54 technical support and conceptual advice. Y. Zhao, Y.Y., and J.L. analyzed the data and wrote the manuscript. DECLARATION OF INTERESTS Y.Y., Y. Zhao, and Q.H. have filed a related patent by East China University of Science and Technology. The remaining authors declare no competing financial interests. 25 / 54 Figure Legends Figure 1. A highly responsive genetically encoded NAD+/AXP ratio sensor. (A) Schematic representation of the NAD+ sensor FiNad. Fluorescent protein cpYFP was inserted into a monomer of NAD+(NADH)-binding bacterial protein T-Rex. Binding of NAD+ induces changes in protein conformation and fluorescence. (B) Fluorescence spectra of purified FiNad in the control condition (black), and saturated NAD+ (dark red). The excitation spectrum recorded at an emission wavelength of 535 nm has a maximum at 500 nm; the emission spectrum recorded at an excitation wavelength of 490 nm has a maximum at 518 nm. (C) Fluorescence responses of FiNad with excitation at 485 nm in the presence of different concentrations of NAD+ and its analogs (n=3). Data are normalized to the initial value. (D) FiNad sensor responds to the indicated [NAD+], but not to the NAD+/NADH ratio (n=3). Data are normalized to the fluorescence in the absence of NAD+. (E) FiNad fluorescence plotted against NAD+/AXP ratio at the indicated total adenine nucleotide concentration (n=3). Data are normalized to the initial value (1mM AXP). (F) The green/red ratio of mCherry-FiNad towards NAD+ or its precursors (n=3). Data are normalized to the initial value. For C, D and F, the total adenine nucleotide concentration was 1 mM. Data are the mean ± s.d. See also Figure S1, Table S1 and Table S2. 26 / 54 Figure 2. Imaging NAD+ metabolism in living bacteria. (A) NAD+ biosynthesis from different precursors in bacteria. (B and C) Microplate assay (B, n=3) and flow cytometric analyses (C) of mCherry-FiNad fluorescence in E. coli BL21 (DE3) cells treated with NAD+ precursors or the pncB inhibitor 2-HNA. (D) Quantification of mCherry-FiNad fluorescence in panel C (n=4). (E and F) Fluorescence images (E) and quantification (F, n=20) of mCherry-FiNad or mCherry-cpYFP in E. coli BL21 (DE3) cells with NAD+ precursors or 2-HNA, scale bar, 2 μm. Data are the mean ± s.e.m (B, D) or mean ± s.d (F), normalized to the control condition (B, D, F). *P 0.05, **P 0.01, ***P 0.001. See also Figure S2 and Table S3. 27 / 54 Figure 3. FiNad sensor reports NAD+ metabolism in living cells and in vivo. (A) The central nodes for cellular NAD+ metabolism. (B and C) Fluorescence images (B) and quantification (C, n=3) of mCherry-FiNad or mCherry-cpYFP in HEK293 cells treated with 10 nM FK866, scale bar, 10 μm. (D) Effects of NAD+ metabolism pathway inhibitors and activators on cytosolic NAD+ measured by mCherry-FiNad fluorescence (n=3). (E and F) Fluorescence images (E) and quantification (F, n=3) of mCherry-FiNad or mCherry-cpYFP in HEK293 cells treated with 5 μM AZD2461, scale bar, 10 μm. (G) Fluorescence response of mCherry-FiNad in live cells to metformin (n=3). (H) General overview of the procedure for in vivo imaging of FiNad in muscle tissues of living mice. (I and J) In vivo fluorescence images (I) and quantification (J) of FiNad or iNapc in muscle tissues of living mice in response to MNNG indicating regions of interest (white dashed line). Images are pseudocolored by R488/405. Scale bar, 100 µm. Data are the mean ± s.e.m (D, G) or mean ± s.d. (C, F), normalized to the control condition (D, G). **P 0.01, ***P 0.001. See also Figure S3. 28 / 54 Figure 4. Mapping the different roles of NAD+ precursors in boosting NAD+ levels in various organisms. (A) Fluorescence images of mCherry-FiNad or mCherry-cpYFP in HEK293 cells treated with NAD+ precursors, scale bar, 10 μm. (B) Quantification of mCherry-FiNad fluorescence corrected by mCherry-cpYFP in panel A (n=25). (C) Effect of different NAD+ precursors (2 mM) on cytosolic NAD+ levels in the absence or presence of FK866 (n=6). (D) Effect of different NAD+ precursors on FK866-triggered cell death shown as a heatmap, with data from Figure S4E. (E and F) Effect of different concentrations of NA on cytosolic NAD+ levels (E) and cell viability (F) in the absence or presence of FK866 (n=6). (G) General overview of the procedure for NAD+ imaging in muscle tissues of mice. (H and I) Fluorescence images (H) and quantification (I, left: n=171, 83, 70, 155, 154; right: n=173, 130, 148, 115, 129) of mCherry-FiNad or mCherry-cpYFP in muscle tissues of mice in response to different NAD+ precursors indicating regions of interest (white dashed line). Images are pseudocolored by R488/561. Scale bar, 100 µm. (J-N) In vivo fluorescence imaging (J, L, M) and quantification (K, n=39, 36, 42, 28, 19, 16, 37, 42, 33, 24; N, n=15, 30, 12, 24, 28, 24, 34, 27, 15, 12) of zebrafish larvae expressing mCherry-FiNad or mCherry-cpYFP in response to different concentrations of NAM (J), NAD+ precursors (L), or FK866 (M) indicating regions of interest. (O) A head-to-head comparison study of four common NAD+ precursors in enhancing NAD+ levels in different species shown as a heatmap, with data from Table S3. Data are the mean ± s.e.m (C, E, F) or mean ± s.d. (B, I, K, N). **P 0.01, ***P 0.001. See also Figure S4 and Table S3. 29 / 54 Figure 5. Increased synthesis of NAD+ controls morphofunctional changes in activated macrophages. (A) NAD+ detection in resting or activated RAW264.7 mouse macrophages expressing mCherry-FiNad or mCherry-cpYFP by flow-cytometry. (B) Quantification of mCherry-FiNad fluorescence corrected by mCherry-cpYFP in panel A (n=3). (C) Immunoblots for enzymes associated with NAD+ synthesis or consumption in resting or activated RAW264.7 cells treated with NAMPT inhibitors. For NAMPT quantification, the means ± s.d. are shown (n=3). (D-L) Effect of NAMPT inhibitors, FK866 or STF118804, on cytosolic NADH/NAD+ ratio measured by SoNar (D, E, n=3), lactate excretion (F, n=3), nitric oxide production measured by DAF-FM DA fluorescence (G, H, n=3), production of proinflammatory cytokines, IL-6 (I, n=4) and TNFα (J, n=4), and phagocytosis efficiency (K, L, n=3) in resting or activated RAW264.7 mouse macrophages. (M) Working models for NAMPT and NAD+ level regulation in resting or activated RAW264.7 mouse macrophages. For B, E, F, H-J, and L, data were obtained from three or more independent assessments and expressed as the mean ± s.e.m, normalized to the control condition in the absence of compounds (B, E, F, L). *P 0.05, **P 0.01, ***P 0.001. See also Figure S5. 30 / 54 Figure 6. Imaging NAD+ decline in cell senescence, in the aging mouse, and in human urine-derived stem cells at different ages. (A and B) Senescence-associated β-galactosidase (SA-β-Gal) staining (A) and quantification (B, n=3) of human diploid fibroblasts (CCC-HPF-1) at late passages (P20, P30). Scale bar, 100 μm. (C and D) Fluorescence imaging (C) and quantification (D, n=34, 21, 20, 11) of CCC-HPF-1 cells expressing mCherry-FiNad or mCherry-cpYFP. Scale bar, 10 μm. (E) Young mice (~2 months) and aged mice (~24 months). (F-I) Fluorescence imaging (F, H) and quantification (G, n=14, 11, 15, 16; I, n=13, 7, 7, 6) of mCherry-FiNad or mCherry-cpYFP in myoblasts (F, G) and cardiomyocytes (H, I) freshly isolated from aged mice (~24 months) or young mice (~2 months). Scale bar, 10 μm. (J) 10-month-old WT and the third generation of telomerase-deficient (G3Terc-/-, G3) mice. (K-N) Fluorescence imaging (K, M) and quantification (L, n=14, 27, 23, 34; N, n=23, 24, 22, 30) of mCherry-FiNad or mCherry-cpYFP in muscle tissues of mice (K, L) and myoblasts (M, N) freshly isolated from WT mice or G3 mice indicating regions of interest (white dashed line). Scale bar, 100 μm (K) or 10 μm (M). (O) General overview of the procedure for isolation and NAD+ imaging of human urine-derived stem cells (hUSC) at different ages. (P and Q) Fluorescence images (P) and quantification (Q , n=50) of mCherry-FiNad in hUSC at different ages. Images are pseudocolored by R488/561. Scale bar, 10 µm. Data are presented as the mean ± s.d. *P 0.05, **P 0.01, ***P 0.001. See also Figure S6. 31 / 54 STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: ● KEY RESOURCES TABLE ● CONTACT FOR REAGENT AND RESOURCE SHARING ● EXPERIMENTAL MODEL AND SUBJECT DETAILS 〇 Cell culture, transfections, and infections 〇 Isolation and culture of primary cells from mice 〇 Isolation of human urine-derived stem cells 〇 Animal studies ● METHOD DETAILS 〇 DNA cloning 〇 Protein expression and purification 〇 Characterization of FiNad in vitro 〇 Fluorescence microscopy 〇 Imaging NAD+ metabolism in muscle tissue and living mice 〇 Imaging NAD+ metabolism in zebrafish larvae 〇 Live-cell fluorescence measurement using microplate reader 〇 Fluorescence-activated cell sorter analysis (FACS) 〇 Western blot 〇 ELISA 〇 Lactate assay 〇 NO detection 〇 Phagocytosis assay 〇 β-galactosidase staining 〇 Measurement of total NAD+ levels 〇 Detection of cellular ATP and ADP levels 〇 Cell viability assay ● QUANTIFICATION AND STATISTICAL ANALYSIS ● DATA AND SOFTWARE AVAILABILITY 32 / 54 SUPPLEMENTAL INFORMATION Supplemental Information includes six figures and three tables and can be found with this article. 33 / 54 STAR★METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-iNOS (D6B6S) Rabbit mAb Cell Signaling Technology Cat# 13120 Anti-PBEF (H-11) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-166946 Anti-NMNAT-2 (B-10) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-515206 Anti-CD38 (H-11) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-374650 Anti-SirT1 (D1D7) Rabbit mAb Cell Signaling Technology Cat# 9475 Anti-SirT2 (D4S6J) Rabbit mAb Cell Signaling Technology Cat# 12672 Anti-pADPr (10H) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-56198 Anti-PARP-1 (B-10) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-74470 Anti-β-Actin (C4) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-47778 Anti-GAPDH (G-9) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-365062 Anti-G6PD (G-12) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-373886 Anti-PGD (G-2) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-398977 Anti-IDH1 (F-3) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-515396 Anti-ME1 (C-6) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-365891 Anti-GSR (C-10) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-133245 Anti-FASN (G-11) Mouse mAb SANTA CRUZ BIOTECHNOLOGY Cat# sc-48357 Anti-MTHFD1 Rabbit pAb Proteintech Cat# 10794-1-AP Bacterial and Virus Strains BL21(DE3) Chemically Competent Cell TRANSGEN BIOTECH CD601 Trans5α Chemically Competent Cell TRANSGEN BIOTECH CD201 Biological Samples Mouse Primary Cardiomyocytes This paper N/A 34 / 54 Mouse Primary Myoblasts This paper N/A Human Urine-derived Stem Cells Shanghai Jiaotong University affiliated Sixth People s Hospital N/A Chemicals, Peptides, and Recombinant Proteins NAD+ Shanghai YEASEN Cat# 60323ES08 NADH Shanghai YEASEN Cat# 60301ES03 NADP+ Shanghai YEASEN Cat# 60324ES03 NADPH Shanghai YEASEN Cat# 60302ES01 ADP Shanghai YEASEN Cat# 60604ES03 ATP Sigma-Aldrich Cat# A26209 AMP Shanghai YEASEN Cat# 60603ES08 Sodium Oxamate Sigma-Aldrich Cat# O2751 Rotenone Sigma-Aldrich Cat# R8875 Oligomycin Aladdin Cat# O111756 Apigenin Sigma-Aldrich Cat# A3145 FK866 Hydrochloride Hydrate Sigma-Aldrich Cat# F8557 Nicotinic Acid (NA) Sigma-Aldrich Cat# N4126 Nicotinamide (NAM) Sigma-Aldrich Cat# N3376 β-Nicotinamide Mononucleotide (β-NMN) Shanghai YEASEN Cat# 60303ES80 Nicotinamide Riboside (NR) Shanghai Yuanye Bio-technology Cat# S24896 Ethyl 3-Aminobenzoate Methanesulfonate (MS-222) Sigma-Aldrich Cat# E10521 Selisistat (EX 527) Selleckchem Cat# S1541 Olaparib (AZD2281) Selleckchem Cat# S1060 AZD2461 Selleckchem Cat# S7029 1-Methyl-3-Nitro-1-Nitrosoguanidine (MNNG) TCI Cat# M0527 2-Hydroxynicotinic Acid (2-HNA) Energy Chemical Cat# A010247 Sodium Pyruvate Thermo Fisher Scientific Cat# 11360070 Lipopolysaccharides (LPS) Shanghai YEASEN Cat# 60322ES10 Recombinant Mouse IFN-γ Absin Bioscience Cat# abs01021 Nω-Nitro-L-Arginine Methyl Ester Hydrochloride (L-NAME) J K Scientific Cat# 257155 Fugene HD Transfection Reagent Promega Cat# E2311 Hieff TransTM Liposomal Transfection Reagent Shanghai YEASEN Cat# 40802ES03 DMEM Media (High Glucose) HyClone Cat# SH30243.01 RPMI Medium Modified (1640) HyClone Cat# SH30809.01B PBS HyClone Cat# SH30013.04 Opti-MEM Invitrogen Cat# 31985-070 Hexadimethrine Bromide Sigma-Aldrich Cat# H9268 Poly-D-Lysine Huaweiruike Chemical Co., Ltd Cat# HWG24863 Sodium Pentobarbital Sigma-Aldrich Cat# P3761 35 / 54 Protease/phosphatase Inhibitor Cocktail Cell Signaling Technology Cat# 5872 Super ECL Detection Reagent Shanghai YEASEN Cat# 36208ES60 Resazurin Sigma-Aldrich Cat# R7017 Diaphorase Aladdin Cat# D128545 Phosphoenolpyruvic Acid Monopotassium Salt Alfa Aesar Cat# B20358.06 Phenazine Methosulfate Macklin Cat# P815754 Thiazolyl Blue Tetrazolium Bromide Aladdin Cat# T100896 DAF-FM DA Probe Beyotime Biotechnology Cat# S0019 Fetal Bovine Serum (FBS) Biological Industries Cat# 04-001-1ACS Trypsin-EDTA Gibco Cat# 25200-072 Human Fibronectin Shanghai YEASEN Cat# 40105ES08 Lactate Dehydrogenase Aladdin Cat# L128329 Pyruvate Kinase Sigma-Aldrich Cat# P1506 Alcohol Dehydrogenase Aladdin Cat# A124756 Critical Commercial Assays Cell Counting Kit-8 (CCK-8) Shanghai YEASEN Cat# 40203ES60 Mouse IL-6 ELISA Kit R D Systems Cat# VAL604 Mouse TNF-α ELISA Kit Abbkine Cat# KET7015 CellTiter-Glo® Luminescent Cell Viability Assay Kit Promega Cat# G7573 Senescence β-Galactosidase Staining Kit Beyotime Biotechnology Cat# C0602 Experimental Models: Cell Lines HEK293T Cell Bank of Chinese Academy of Science GNHu17 HEK293 Cell Bank of Chinese Academy of Science GNHu43 RAW264.7 Mouse Macrophages Cell Bank of Chinese Academy of Science TCM13 Human Fibroblasts CCC-HPF-1 Laboratory Animal Center of Hangzhou Normal University N/A Experimental Models: Organisms/Strains C57BL/6J Mice Laboratory Animal Center of Hangzhou Normal University N/A Kunming Mice Jiesijie Experimental Animal Co., Ltd N/A The Third Generation of Telomerase-dysfunctional Mice (refer as G3Terc-/- or G3 ) from Prof. Lenhard K. Rudolph N/A 36 / 54 Zebrafish Larvae Zebrafish core facility, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences N/A Oligonucleotides Primer sequences for cloning or sequencing, see Table S1 This paper N/A Recombinant DNA pcDNA3.1-FiNad This paper N/A pcDNA3.1-mCherry-FiNad This paper N/A pcDNA3.1-mCherry-cpYFP This paper N/A pLVX-mCherry-FiNad This paper N/A pLVX-mCherry-cpYFP This paper N/A pcDNA3.1-SoNar Zhao et al., 2015 Cell Metabolism N/A pcDNA3.1-cpYFP Zhao et al., 2015 Cell Metabolism N/A pcDNA3.1-iNap1 Tao et al., 2017 Nature Methods N/A pcDNA3.1-iNapc Tao et al., 2017 Nature Methods N/A pCDFDuet-mCherry-FiNad This paper N/A pCDFDuet-mCherry-cpYFP This paper N/A psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 pCDFDuet-LigA-cpVenus Cambronne et al., 2016 Science N/A pCDFDuet-cpVenus Cambronne et al., 2016 Science N/A GW1-PercevalHR Addgene #49082 Software and Algorithms Image J 1.50d Fiji http://fiji.sc/ GraphPad Prism V6.01 GraphPad Software https://download.cnet.com/s/graphpad-prism-6-01/ SigmaPlot 12.0 SigmaPlot Software https://sigmaplot.software.informer.com/12.0/ Gen5 1.05 Biotek https://www.biotek.com/products/software-robotics/ 37 / 54 CytExpert 2.0 Beckman Coulter https://www.beckman.com/flow-cytometry/instruments/cytoflex/software NIS-Elements AR Analysis Version 5.11.01 Nikon https://www.nikon.com/products/microscope-solutions/support/download/software/imgsfw/nis-ar_v5110164.htm Other 35 mm Glass Bottom Dish Cellvis D35-20-1-N 96-well Glass Bottom Plate Cellvis P96-1-N CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yuzheng Zhao (yuzhengzhao@ecust.edu.cn); and Yi Yang (yiyang@ecust.edu.cn). All these materials, including FiNad, mCherry-FiNad, mCherry-cpYFP, SoNar, iNap1, and iNapc, are available upon requests. EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell culture, transfections, and infections HEK293 cells (Cell Bank of Chinese Academy of Science) and Human fibroblasts CCC-HPF-1(Laboratory Animal Center of Hangzhou Normal University) were maintained in DMEM (high glucose) (Hyclone) with 10% FBS (Biological Industries) at 37 °C in a humidified atmosphere of 95% air and 5% CO2. Cells were plated in antibiotic-free DMEM (high glucose) supplemented with 10% FBS 16-24 h before transfection. We typically used 0.1 μg plasmids with 0.25 μL Hieff TransTM liposomal transfection reagent for each well of a 96-well plate according to the manufacturer’s protocol. 38 / 54 RAW264.7 mouse macrophages (Cell Bank of Chinese Academy of Science) were grown in RPMI 1640 (Hyclone) supplemented with 10% FBS. RAW264.7 cells were transiently transfected with sensors using FuGENE HD transfection reagent (Promega). To activate macrophages, LPS (0.5 µg/mL) and IFN-γ (250 U/mL) were added 24 h after transfection for 14-16 h. The entire coding sequence for mCherry-FiNad or mCherry-cpYFP was subcloned into a pLVX-Puro vector. Lentivirus was produced by co-transfecting two lentiviral packaging vectors (pMD2.G and psPAX2) in HEK293T cells. Lentiviral supernatants were collected 48 and 72 h after transfection. Primary cells in 96-well tissue culture plates were infected with lentivirus in media containing 8 μg/mL polybrene and centrifuged at 1,800 rpm for 1 h. Post-infection 6 h, virus was removed and cells were then cultured for 48-72 h. The recombinant adenoviruses of mCherry-FiNad or mCherry-cpYFP were generated from OBiO Technology (Shanghai). Human urine-derived stem cells were infected with adenoviruses for 36 h in 96-well glass bottom plates, and then imaged. Isolation and culture of primary cells from mice Primary cardiomyocytes were isolated as described by a Langendorff-free method (Ackers-Johnson et al., 2016). Briefly, the heart was sequentially perfused with 7 mL EDTA buffer, 5 mL perfusion buffer, 40 mL collagenase buffer and, finally, inhibition of enzymatic activity by adding 5 mL stop buffer. The heart was transferred to a 60-mm dish and teased apart into small pieces following with 15 times of gentle pipetting. The cells were passed through a 100 µm nylon mesh and underwent 4 sequential rounds of gravity settling, using 0, 0.3, 0.6, and 1.2 mM calcium recovery solution. The purified cardiomyocytes were 39 / 54 immediately resuspended in plating medium (M199, 1 x penicillin/streptomycin, 5% FBS, 10 mM 2,3-butanedione monoxime) for 1 day and further cultured in culture media (M199, 1 x penicillin/streptomycin, 0.1% Bovine serum albumin, 10 mM 2,3-butanedione monoxime, 1 x Insulin/transferrin/selenium supplement (ITS) and 1 x chemically defined lipid (CD lipid) for further experiments. Primary myoblasts were isolated from skeletal muscle as previous protocol(Hindi et al., 2017). Briefly, skeletal muscle tissues were minced and digested with collagenase II. The digested tissues were further pelleted by centrifugation, and cells were sequentially passed through a 70-µm and 40-µm filter. The cell suspension was spun down again and resuspended in myoblast growth media with fibroblast growth factor. After a 3-day culture on a matrigel-coated dish, cells were trypsinized and plating steps repeated until 95% myoblast purity was achieved. Isolation of human urine-derived stem cells Human urine-derived stem cells (hUSC) at different ages were obtained from anonymized healthy volunteers under protocols approved by the Institutional Review Board of Shanghai Jiaotong University Affiliated Sixth People s Hospital, with the informed consent of all participants. The study enrolled 6 healthy male individuals at the age of 24, 24, 27, 40, 46 and 56 years. After mid and last stream urine was collected, and 5 ml antibiotic-antimycotic was added into 250 ml urine samples. Urine samples were centrifuged at 500 g for 10 min at room temperature, then the supernatant was discarded and the sediment was washed with phosphate-buffered saline (PBS). Cells were centrifuged again, and then the sediment was resuspended with USC culture medium (contained 44% Dulbecco’s modified Eagle medium, 40 / 54 0.25% Penicillin-Streptomycin, 5% fetal bovine serum, 10 ng/ml of human epidermal growth factor, 2 ng/ml of platelet-derived growth factor, 2 ng/ml of basic fibroblast growth factor, 0.5 % GlutaMax, 0.5 % non-essential amino acids solution and 52 % REGM BulletKit). The cell suspension was seeded into gelatin-coated 6-well plates and incubated at 37 °C in a humidified atmosphere with 5 % CO2. The medium was changed after 7 days of culture and the non-adherent cells were removed by washing with PBS. The colonies derived from single cells were marked, cultured, and further evaluated by the staining of stem cell surface markers according to the previously described methods(Zhang et al., 2008; Zhou et al., 2012). Animal studies C57BL/6J mice (refer as wild type or WT ) were provided from the Laboratory Animal Center of Hangzhou Normal University. Kunming mice, an outbred stock derived from Swiss albino mice, were purchased from Jiesijie Experimental Animal Co., Ltd (Shanghai, China). The third generation of telomerase-dysfunctional mice (refer as G3Terc-/- or G3 ) were originally gifted from Prof. Lenhard K. Rudolph. Young (2 months) and old (24 months) WT mice, and G3 mice were all maintained in a specific-pathogen-free facility with a 12 h light / 12 h dark cycle and food and water available ad libitum. The Terc genotyping protocol is: 94 °C , 5 min; 34 cycles of (94 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s); 72 °C, 5 min; and 4 °C hold, using the following primers: mTRWtF 5’-CTAAGCCGGCACTCCTTACAAG-3’, 5PPGK 5’-GGGGCTGCTAAAGCGCAT-3’, and mTRR 5’-TTCTGACCACCACCAACTTCAAT-3’. Size of fragments: wildtype ~ 200 bp and knockout ~ 180 bp. All procedures involving animals were approved by the Institutional Animal Care and Use Committee of Hangzhou Normal 41 / 54 University, and East China University of Science and Technology. Wild-type AB zebrafish embryos at one or two-cell stage were provided from zebrafish core facility, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. Embryos were cultured in a Petri dish with egg water (60 μg/mL Sea salts) at 28.5 °C, and then the fertilized egg developed into zebrafish larvae. The handling procedures were approved by the Institutional Animal Care and Use Committee of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. METHOD DETAILS DNA cloning For bacterial expression, FiNad was cloned into BamHI and XhoI sites of the pCDFDuet-1 vector (Novagen) (Table S1). For mammalian expression, the entire coding sequences of FiNad were subcloned into pcDNA3.1 Hygro(+) (Invitrogen) behind a Kozak sequence. For nuclear targeting (Table S1), the three-fold nuclear localization signal (3xNLS) DPKKKRKVDPKKKRKVDPKKKRKV was added to the C-terminus of sensors. For construction of lentivirus vectors, mCherry-FiNad and mCherry-cpYFP were ligated into the pLVX-IRES-Puro plasmid digested by XhoI and XbaI (Table S1). The PercevalHR sensors were obtained from Addgene. The gene encoding LigA-cpVenus was synthesized according to the amino acid sequence previously reported (Cambronne et al., 2016) and cloned into pCDFDuet-1 vector. Protein expression and purification All recombinant proteins with a 6× His-tag were expressed in Escherichia coli BL21 (DE3) by pCDFDuet-1 expression plasmid. Cultures were grown in Luria–Bertani (LB) media containing 50 μg/mL streptomycin at 37 °C until the cultures reached an OD600 of 0.3. Moreover, the 42 / 54 growth temperature was shifted to 18 °C and protein expression was induced by the addition of 1 mM IPTG. After 24 h of incubation, bacteria were harvested and suspended in 50 mM potassium phosphate buffer, pH 7.4, containing 500 mM NaCl and 10 mM imidazole (buffer A), and lysed via ultrasonication. Cell lysate was centrifuged at 10,000 ×g for 30 min at 4 °C, and the supernatant was loaded onto a column of Ni2+ affinity chromatography. After washing with two column volumes of wash buffer (buffer A containing 30 mM imidazole), the proteins were eluted from the resin using 50 mM potassium phosphate buffer, pH 7.4, containing 500 mM sodium chloride and 300 mM imidazole. The protein preparations were then desalted and exchanged into 100 mM HEPES buffer containing 100 mM NaCl (pH 7.4) with a Sephadex column. Protein was diluted to the required concentration before assay. Characterization of FiNad in vitro We stored the purified protein at -80 °C until experiments. Measurement of excitation and emission spectra of recombinant fluorescent sensor proteins was carried out as previously described (Zhao et al., 2015; Zhao et al., 2011). The purified sensor protein was placed into a cuvette containing 100 mM HEPES buffer with 100 mM sodium chloride (pH 7.4). Fluorescence was measured using a spectrofluorometer (EnSpire). Excitation spectra of FiNad and mCherry were recorded with an excitation range from 400 nm to 511 nm or 540 nm to 605 nm and an emission wavelength of 535 nm or 615 nm, respectively. For emission spectra, the emission range of FiNad and mCherry were 507-575 nm or 600-660 nm, while the excitation wavelength was 490 nm or 580 nm, respectively. Readings were taken every 1 nm with an integration time of 1 s, and the photomultiplier tube (PMT) voltage was set at 655 V (Green) or 600 V (Red). 43 / 54 For nucleotide titration, the protein was diluted in 100 mM HEPES buffer (pH 7.4) to a final concentration of 0.5 μM. The fluorescence value of FiNad or mCherry-FiNad, in the presence of nucleotides, was measured by a filter-based Synergy 2 Multi-Mode microplate reader using 485 BP 20 nm (or 420 BP 10 nm) or 590 BP 20 nm excitation, and 528 BP 20 nm or 645 BP 40 nm emission band-pass filters (BioTek). The stock solution of nucleotides was also prepared in 100 mM HEPES buffer (pH 7.4). Each assay was performed with 50 μL nucleotides and 50 μL protein in black 96-well flat bottom plate. Fluorescence intensity was measured immediately. Fluorescence microscopy For imaging of mammalian cells, cells were plated on 35 mm glass-bottom dish or 96-well glass-bottom plate. The mCherry-FiNad or mCherry-cpYFP sensors were expressed in subcellular compartments by tagging with organelle-specific signal peptides. Images were acquired using a Leica TCS SP8 SMD confocal laser scanning microscope system with super-sensitive HyD hybrid detectors. HC Plan Apo CS2 63×/1.40 NA oil objective was utilized. For dual-excitation ratio imaging, a 488-nm excitation laser and 500- to 550-nm emission range, and a 561-nm excitation laser and a 570- to 630-nm emission range were used. Raw data were exported to ImageJ software as 12-bit TIF for analysis. The pixel-by-pixel ratio of the 488 nm excitation green image by the 561 nm excitation red image of the same cell was used to pseudocolor the images in HSB color space as previously described(Zhao et al., 2015; Zhao et al., 2011). For imaging of E. coli BL21 (DE3), cells were diluted to an OD600 of 0.4, and then seeded into 96-well glass-bottom plate pre-coated with 0.1 mg/mL poly-D-lysine. After ~10 min, 44 / 54 cells were fixed by adding a drop of 1.5% low melting point agarose to each well. mCherry-FiNad fluorescence was visualized by a Leica TCS SP8 SMD confocal laser scanning microscope system with super-sensitive HyD hybrid detectors and an HC Plan Apo CS2 63×/1.40 NA oil objective. Imaging NAD+ metabolism in muscle tissue and living mice Mice were anesthetized intraperitoneally with sodium pentobarbital (60 mg/kg body weight). The mCherry-FiNad or mCherry-cpYFP sensor was transferred into muscle tissue via electroporation. Electrode needles were inserted into the muscle to a depth of 5 mm together with the syringe. 30-50 µg of purified DNA of mCherry-FiNad, mCherry-cpYFP, FiNad, or iNapc plasmid at 1 µg/µL in ddH2O were then injected into the leg skeleton muscles of mice with the syringe. Electric pulses were delivered immediately using an in vivo electroporator (TERESA-EPT I, Teresa) after removing the syringe. Six 50-msec-long pulses of 60 V voltage, 1 Hz were administered to each injection site at a rate of one pulse per sec. All procedures involving animals were approved by the Institutional Animal Care and Use Committee of East China University of Science and Technology. For in vivo imaging of living mice, mice were anesthetized intraperitoneally with sodium pentobarbital at 5-7 days after electroporation. The electroporated muscle legs were depilated by shaver to reduce the fluorescence interference of hairs, and then placed on glass cover slips for imaging. For ex vivo imaging of muscle tissues, leg skeletal muscle was isolated from C57BL/6J mice or Kunming mice, and then sectioned with a Leica VT1200 S Fully automated vibrating blade microtome. The parameters were set to 3 mm amplitude, 1 mm/s speed, and 300 μm step size (thickness). Muscle sections were maintained in PBS 45 / 54 and then placed evenly between two glass cover slips for imaging. Fluorescence was detected by a Leica TCS SP8 SMD confocal laser scanning microscope system with super-sensitive HyD hybrid detectors and an HC Plan APO CS2 20×/0.75 NA dry objective. For dual-excitation ratio imaging, a 488-nm excitation laser and 500- to 550-nm emission range, and a 561-nm excitation laser (or a 405-nm excitation laser) and a 570- to 630-nm (or 500- to 550-nm) emission range were used. Imaging NAD+ metabolism in zebrafish larvae One nL of mixture containing 4 mg/mL mCherry-FiNad or mCherry-cpYFP sensor protein in HEPES buffer was microinjected to the animal pole of wild-type AB zebrafish embryos at one or two-cell stage. Embryos were collected and placed in a Petri dish with egg water (60 μg/mL Sea salts) at 28.5 °C. The embryos were transferred into a 12-well culture plate (~20 embryos per well) at 6 h or 30 h post fertilization, and then incubated for ~24 h with NAD+ precursors or NAMPT inhibitor in egg water (60 μg/mL Sea salts). Zebrafish larvae were anesthetized with 0.6 mM tricaine in E3 medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) prior to imaging. If necessary, zebrafish larvae were dechorionated under the stereomicroscope using fine tweezers. The handling procedures were approved by the Institutional Animal Care and Use Committee of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Live-cell fluorescence measurement using microplate reader For E. coli BL21 (DE3), cells were seeded into glass tubes and cultured as the protein expression procedure. Bacteria cultures were diluted into an OD600 of 0.4, and then incubated with NAD+ precursors or NAPRT inhibitor 2-HNA for 2 h at 37 °C. After 2 h, 46 / 54 bacteria were pelleted by centrifugation, washed twice with HEPES buffer, and then diluted into an OD600 of 0.2 for detection. Readings were recorded at 37 °C by a Synergy 2 Multi-Mode Microplate Reader (BioTek) with excitation filters 485 BP 20 nm and 590 BP 20 nm, and emission filter 528 BP 20 nm and 645 BP 40 nm, respectively. For mammalian cells, cells were seeded in black 96-well flat bottom plate, transfected with the plasmid DNA of mCherry-FiNad or mCherry-cpYFP and expressed for 36 h. Cells were washed twice with PBS after carefully removing the medium. Data were recorded immediately after adding 100 μL PBS at 37 °C by a Synergy 2 Multi-Mode Microplate Reader (Bio Tek) with excitation filters 485 BP 20 nm and 590 BP 20 nm, and emission filter 528 BP 20 nm and 645 BP 40 nm, respectively. Fluorescence values were background corrected by subtracting the intensity of the cell samples not expressing sensors. Unless otherwise indicated, 25 mM glucose and 0.2 mM pyruvate was maintained in the buffer. NAD+/NADH ratio and ATP/ADP ratio in live cells were measured using SoNar(Zhao et al., 2015) and PercevalHR (Tantama et al., 2013) as with FiNad described above, respectively. Fluorescence-activated cell sorter analysis (FACS) After treatment with NAMPT inhibitors, RAW264.7 mouse macrophages were scraped and monitored using FACS. FACS was performed with CytoFLEX-S flow cytometer (Beckman Coulter). Cells expressing mCherry-FiNad and mCherry-cpYFP sensors were excited using laser lines at 488 nm and 561 nm. Emission filters were 525 BP 40 nm and 610 BP 20 nm for the two excitation wavelengths separately. Cells expressing SoNar, iNap1 or iNapc sensors were excited using laser lines at 405 nm and 488 nm. Emission filters were 525 BP 40 nm for both excitation wavelengths. 47 / 54 E. coli BL21 (DE3) cells expressing mCherry-FiNad, mCherry-cpYFP, LigA-cpVenus, or cpVenus sensors were treated with NAD+ precursors, or NAPRT inhibitor 2-HNA for 2 h. Cells were pelleted by centrifugation, washed twice, and then resuspended into HEPES buffer. After 30 min, fluorescence was measured with FACS. Western blot For the Western blot analyses, cells were lysed in 1X SDS sample buffer supplemented with a protease/phosphatase inhibitor cocktail (Cell Signaling Technology). Equal amounts of total protein (30-60 μg) were separated on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and electrotransferred onto PVDF membranes. Membranes were incubated with primary antibodies: NAMPT (sc-166946), NMNAT2 (sc-515206), CD38 (sc-374650), PAR (sc-56198), PARP1 (sc-74470), G6PD (sc-373886), PGD (sc-398977), IDH1 (sc-515396), ME1 (sc-365891), GSR (sc-133245), FASN (sc-48357), β-actin (sc-47778), and GAPDH (sc-365062) (Santa Cruz Biotechnologies); iNOS (#13120), SIRT1 (#9475), and SIRT2 (#12672) (Cell Signaling Technology); and MTHFD1 (10794-1-AP) (Proteintech), followed by secondary antibodies conjugated to horseradish peroxidase, and addition of chemiluminescence detection mixture (YEASEN, 36208ES60) and imaged. ELISA RAW264.7 mouse macrophages were cultured in 12-well plate and exposed to activators combined with NAMPT inhibitors for 12 h. The supernatant was removed and the fresh medium was added for 4 h incubation. The medium was then collected by centrifugation after 4 h. The content of IL-6 and TNF-α was determined immediately by using mouse IL-6 ELISA kit (R D Systems, VAL604) and mouse TNF-α ELISA kit (Abbkine, KET7015) according to 48 / 54 the manufacturer’s protocol, respectively. Lactate assay RAW264.7 mouse macrophages were exposed to activators combined with NAMPT inhibitors for 14 h. The supernatant was removed; and cells were washed once with fresh medium and was incubated for 1 h with NAMPT inhibitors. The medium was then collected to 1.5 mL EP tubes, and deproteined with equal volume of 0.5 M HClO4, neutralized with 3 M KOH, and centrifuged at 4 ○C, 10, 000 g for 5 min. The supernatant was pipetted carefully to new EP tubes for assay. 50 μL samples were mixed with equal volume of reaction medium containing 20 μM resazurin, 0.4 U/mL diaphorase, 1 mM NAD+, and 1 U/mL lactate dehydrogenase. Changes in fluorescence excited at 540 nm and emitted at 590 nm were measured every 20 seconds for 10 min at 37 °C by a Synergy 2 Multi-Mode Microplate Reader. NO detection RAW264.7 mouse macrophages were cultured in 24-well plate and exposed to activators combined with NAMPT inhibitors for 14 h. After removing the medium, cells were washed once with PBS and then stained with 200 μL 5 μM DAF-FM DA probe (Beyotime, S0019) at 37 ○C for 30 min. The cells were washed three times with PBS after 30 min, collected, and detected by flow cytometer (Beckman, CytoFLEX-S) with laser line at 488 nm and emission filter 525 BP 40 nm. Phagocytosis assay RAW264.7 mouse macrophages were seeded in 12 well-plate for ~24 h, and then washed three times with PBS and incubated with E. coli BL21(DE3) cells expressing superfolder GFP(Pedelacq et al., 2006) at 37 ○C for 30 min in serum-free 1640 medium. The 49 / 54 bacteria-to-cell ratio was approximately 50:1. The bacteria were removed after 30 min, and RAW264.7 cells were washed three times with PBS containing 1 mM EDTA. Cell samples were then resuspended with PBS-EDTA and analyzed by FACS. The phagocytic index of each sample was characterized as the mean superfolder GFP fluorescence multiplied by the percent of the positive population. β-galactosidase staining Human fibroblasts CCC-HPF-1 were fixed in cold 4 % paraformaldehyde for 3 h, then washed with PBS and stained at 37 °C for 18 h in the presence of 1 mM X-gal. RGB images were taken by high-performance fluorescent microscopy system equipped with Nikon Eclipse Ti-E automatic microscope and Nikon DS-Fi2 camera. Measurement of total NAD+ levels NAD+ levels were measured by the enzymatic cycling assay according to a previously described method(Szabo et al., 1996; Ying et al., 2001). NAD+ levels were assessed based on the reduction of MTT to formazan through phenazine methosulfate facilitation. Cells were treated with different reagents for 24 h (MNNG treatment for 30 min) and then extracted and assayed. Relative NAD+ level was calculated by normalizing cell number or protein level. Detection of cellular ATP and ADP levels The ATP assay is based on CellTiter-Glo luminescent cell viability assay kit (Promega). Briefly, luciferase catalyzes the conversion of ATP and D-luciferin to light, which is measured by a Synergy 2 Multi-Mode Microplate Reader. The ADP level is measured by its conversion to ATP through Pyruvate kinase (Sigma, P1506) that is subsequently detected using the same reaction. Relative AXP level ([ATP]+[ADP]) was calculated by normalizing cell number or 50 / 54 protein level. Cell viability assay Cells were plated at a density of 8×103 cells in triplicate in 96-well plates. After ~20 h, cells were treated with different compounds. The cells were then cultured for 48 h, and cell viability was evaluated by Cell Counting Kit-8 (CCK-8). QUANTIFICATION AND STATISTICAL ANALYSIS Data are presented either as a representative example of a single experiment repeated at least in triplicate or as three or more experiments. Data are presented as mean ± s.d. or mean ± s.e.m. All P values were obtained using unpaired two-tailed Student’s t-test. Values of P 0.05 were considered statistically significant (*P 0.05, **P 0.01 and ***P 0.001). DATA AND SOFTWARE AVAILABILITY All data supporting the findings of this study are available within the article and its Supplemental Information files. All constructs, including FiNad, mCherry-FiNad, mCherry-cpYFP, SoNar, iNap1 and iNapc, are available on request. 51 / 54 REFERENCES Ackers-Johnson, M., Li, P.Y., Holmes, A.P., O Brien, S.M., Pavlovic, D., and Foo, R.S. (2016). A Simplified, Langendorff-Free Method for Concomitant Isolation of Viable Cardiac Myocytes and Nonmyocytes From the Adult Mouse Heart. Circ Res 119, 909-920. Bilan, D.S., Matlashov, M.E., Gorokhovatsky, A.Y., Schultz, C., Enikolopov, G., and Belousov, V.V. (2014). Genetically encoded fluorescent indicator for imaging NAD(+)/NADH ratio changes in different cellular compartments. Biochim Biophys Acta 1840, 951-957. Bonkowski, M.S., and Sinclair, D.A. (2016). Slowing ageing by design: the rise of NAD+ and sirtuin-activating compounds. Nat Rev Mol Cell Biol 17, 679-690. Cambronne, X.A., Stewart, M.L., Kim, D., Jones-Brunette, A.M., Morgan, R.K., Farrens, D.L., Cohen, M.S., and Goodman, R.H. (2016). Biosensor reveals multiple sources for mitochondrial NAD(+). Science 352, 1474-1477. Cameron, W.D., Bui, C.V., Hutchinson, A., Loppnau, P., Graslund, S., and Rocheleau, J.V. (2016). Apollo-NADP(+): a spectrally tunable family of genetically encoded sensors for NADP(+). Nat Methods 13, 352-358. Canto, C., Houtkooper, R.H., Pirinen, E., Youn, D.Y., Oosterveer, M.H., Cen, Y., Fernandez-Marcos, P.J., Yamamoto, H., Andreux, P.A., Cettour-Rose, P., et al. (2012). The NAD(+) precursor nicotinamide riboside enhances oxidative metabolism and protects against high-fat diet-induced obesity. Cell Metab 15, 838-847. Canto, C., Menzies, K.J., and Auwerx, J. (2015). NAD(+) metabolism and the control of energy homeostasis: a balancing act between mitochondria and the nucleus. Cell Metab 22, 31-53. Carling, D., Mayer, F.V., Sanders, M.J., and Gamblin, S.J. (2011). AMP-activated protein kinase: nature s energy sensor. Nat Chem Biol 7, 512-518. Chan, L.N., Chen, Z., Braas, D., Lee, J.W., Xiao, G., Geng, H., Cosgun, K.N., Hurtz, C., Shojaee, S., Cazzaniga, V., et al. (2017). Metabolic gatekeeper function of B-lymphoid transcription factors. Nature 542, 479-483. Fang, E.F., Lautrup, S., Hou, Y., Demarest, T.G., Croteau, D.L., Mattson, M.P., and Bohr, V.A. (2017). NAD(+) in Aging: Molecular Mechanisms and Translational Implications. Trends Mol Med 23, 899-916. Ghesquiere, B., Wong, B.W., Kuchnio, A., and Carmeliet, P. (2014). Metabolism of stromal and immune cells in health and disease. Nature 511, 167-176. Grose, J.H., Bergthorsson, U., and Roth, J.R. (2005). Regulation of NAD synthesis by the trifunctional NadR protein of Salmonella enterica. J Bacteriol 187, 2774-2782. Hardie, D.G., Ross, F.A., and Hawley, S.A. (2012). AMPK: a nutrient and energy sensor that maintains energy homeostasis. Nat Rev Mol Cell Biol 13, 251-262. Hindi, L., McMillan, J.D., Afroze, D., Hindi, S.M., and Kumar, A. (2017). Isolation, Culturing, and Differentiation of Primary Myoblasts from Skeletal Muscle of Adult Mice. Bio-protocol 7, e2248. Hung, Y.P., Albeck, J.G., Tantama, M., and Yellen, G. (2011). Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor. Cell Metab 14, 545-554. Imai, S.I., and Guarente, L. (2014). NAD and sirtuins in aging and disease. Trends Cell Biol 24, 464-471. Joubert, F., Fales, H.M., Wen, H., Combs, C.A., and Balaban, R.S. (2004). NADH enzyme-dependent fluorescence recovery after photobleaching (ED-FRAP): applications to enzyme and mitochondrial reaction kinetics, in vitro. Biophys J 86, 629-645. Kang, H., Oka, S., Lee, D.Y., Park, J., Aponte, A.M., Jung, Y.S., Bitterman, J., Zhai, P., He, Y., Kooshapur, H., et al. (2017). Sirt1 carboxyl-domain is an ATP-repressible domain that is transferrable to other proteins. 52 / 54 Nat Commun 8, 15560. Kraya, T., Neumann, L., Paelecke-Habermann, Y., Deschauer, M., Stoevesandt, D., Zierz, S., and Watzke, S. (2017). Cognitive impairment, clinical severity and MRI changes in MELAS syndrome. Mitochondrion 44, 53-57. Misto, A., Provensi, G., Vozella, V., Passani, M.B., and Piomelli, D. (2019). Mast Cell-Derived Histamine Regulates Liver Ketogenesis via Oleoylethanolamide Signaling. Cell Metab 29, 91-102. Mitchell, S.J., Bernier, M., Aon, M.A., Cortassa, S., Kim, E.Y., Fang, E.F., Palacios, H.H., Ali, A., Navas-Enamorado, I., Di Francesco, A., et al. (2018). Nicotinamide improves aspects of healthspan, but not lifespan, in mice. Cell Metab 27, 667-676. Noda, T., and Amano, F. (1997). Differences in nitric oxide synthase activity in a macrophage-like cell line, RAW264.7 cells, treated with lipopolysaccharide (LPS) in the presence or absence of interferon-gamma (IFN-gamma): possible heterogeneity of iNOS activity. J Biochem 121, 38-46. Park, J.O., Rubin, S.A., Xu, Y.F., Amador-Noguez, D., Fan, J., Shlomi, T., and Rabinowitz, J.D. (2016). Metabolite concentrations, fluxes and free energies imply efficient enzyme usage. Nat Chem Biol 12, 482-489. Pedelacq, J.D., Cabantous, S., Tran, T., Terwilliger, T.C., and Waldo, G.S. (2006). Engineering and characterization of a superfolder green fluorescent protein. Nat Biotechnol 24, 79-88. Plowden, J., Renshaw-Hoelscher, M., Engleman, C., Katz, J., and Sambhara, S. (2004). Innate immunity in aging: impact on macrophage function. Aging Cell 3, 161-167. Poyan Mehr, A., Tran, M.T., Ralto, K.M., Leaf, D.E., Washco, V., Messmer, J., Lerner, A., Kher, A., Kim, S.H., Khoury, C.C., et al. (2018). De novo NAD(+) biosynthetic impairment in acute kidney injury in humans. Nat Med 24, 1351-1359. Rajman, L., Chwalek, K., and Sinclair, D.A. (2018). Therapeutic potential of NAD-boosting molecules: the in vivo evidence. Cell Metab 27, 529-547. Ryu, K.W., Nandu, T., Kim, J., Challa, S., DeBerardinis, R.J., and Kraus, W.L. (2018). Metabolic regulation of transcription through compartmentalized NAD(+) biosynthesis. Science 360, eaan5780. Sahin, E., Colla, S., Liesa, M., Moslehi, J., Muller, F.L., Guo, M., Cooper, M., Kotton, D., Fabian, A.J., Walkey, C., et al. (2011). Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 470, 359-365. Sallin, O., Reymond, L., Gondrand, C., Raith, F., Koch, B., and Johnsson, K. (2018). Semisynthetic biosensors for mapping cellular concentrations of nicotinamide adenine dinucleotides. eLife 7, e32638. Solana, R., Pawelec, G., and Tarazona, R. (2006). Aging and innate immunity. Immunity 24, 491-494. Szabo, C., Zingarelli, B., O Connor, M., and Salzman, A.L. (1996). DNA strand breakage, activation of poly (ADP-ribose) synthetase, and cellular energy depletion are involved in the cytotoxicity of macrophages and smooth muscle cells exposed to peroxynitrite. Proc Natl Acad Sci U S A 93, 1753-1758. Takasawa, S., Tohgo, A., Noguchi, N., Koguma, T., Nata, K., Sugimoto, T., Yonekura, H., and Okamoto, H. (1993). Synthesis and hydrolysis of cyclic ADP-ribose by human leukocyte antigen CD38 and inhibition of the hydrolysis by ATP. J Biol Chem 268, 26052-26054. Tantama, M., Martinez-Francois, J.R., Mongeon, R., and Yellen, G. (2013). Imaging energy status in live cells with a fluorescent biosensor of the intracellular ATP-to-ADP ratio. Nature communications 4, 2550. Tao, R., Zhao, Y., Chu, H., Wang, A., Zhu, J., Chen, X., Zou, Y., Shi, M., Liu, R., Su, N., et al. (2017). 53 / 54 Genetically encoded fluorescent sensors reveal dynamic regulation of NADPH metabolism. Nat Methods 14, 720-728. Tateishi, K., Wakimoto, H., Iafrate, A.J., Tanaka, S., Loebel, F., Lelic, N., Wiederschain, D., Bedel, O., Deng, G., Zhang, B., et al. (2015). Extreme Vulnerability of IDH1 Mutant Cancers to NAD+ Depletion. Cancer Cell 28, 773-784. Toledano, E., Ogryzko, V., Danchin, A., Ladant, D., and Mechold, U. (2012). 3 -5 phosphoadenosine phosphate is an inhibitor of PARP-1 and a potential mediator of the lithium-dependent inhibition of PARP-1 in vivo. Biochem J 443, 485-490. Tyrakis, P.A., Palazon, A., Macias, D., Lee, K.L., Phan, A.T., Velica, P., You, J., Chia, G.S., Sim, J., Doedens, A., et al. (2016). S-2-hydroxyglutarate regulates CD8(+) T-lymphocyte fate. Nature 540, 236-241. Vander Heiden, M.G. (2017). Metabolism and congenital malformations-NAD s effects on development. N Engl J Med 377, 509-511. Verdin, E. (2014). The many faces of sirtuins: Coupling of NAD metabolism, sirtuins and lifespan. Nat Med 20, 25-27. Verdin, E. (2015). NAD(+) in aging, metabolism, and neurodegeneration. Science 350, 1208-1213. Wang, E., Bauer, M.C., Rogstam, A., Linse, S., Logan, D.T., and von Wachenfeldt, C. (2008). Structure and functional properties of the Bacillus subtilis transcriptional repressor Rex. Mol Microbiol 69, 466-478. Wang, J., Zhao, Y., Wang, C., Zhu, Q., Du, Z., Hu, A., and Yang, Y. (2015). Organelle-Specific Nitric Oxide Detection in Living Cells via HaloTag Protein Labeling. PLoS One 10, e0123986. Ying, W., Sevigny, M.B., Chen, Y., and Swanson, R.A. (2001). Poly(ADP-ribose) glycohydrolase mediates oxidative and excitotoxic neuronal death. Proc Natl Acad Sci U S A 98, 12227-12232. Yoshino, J., Baur, J.A., and Imai, S.I. (2018). NAD(+) intermediates: the biology and therapeutic potential of NMN and NR. Cell Metab 27, 513-528. Yoshino, J., Mills, K.F., Yoon, M.J., and Imai, S. (2011). Nicotinamide mononucleotide, a key NAD(+) intermediate, treats the pathophysiology of diet- and age-induced diabetes in mice. Cell Metab 14, 528-536. Zhang, Q., Piston, D.W., and Goodman, R.H. (2002). Regulation of corepressor function by nuclear NADH. Science 295, 1895-1897. Zhang, Y., McNeill, E., Tian, H., Soker, S., Andersson, K.E., Yoo, J.J., and Atala, A. (2008). Urine derived cells are a potential source for urological tissue reconstruction. J Urol 180, 2226-2233. Zhao, Y., Hu, Q., Cheng, F., Su, N., Wang, A., Zou, Y., Hu, H., Chen, X., Zhou, H.M., Huang, X., et al. (2015). SoNar, a Highly Responsive NAD+/NADH Sensor, Allows High-Throughput Metabolic Screening of Anti-tumor Agents. Cell Metab 21, 777-789. Zhao, Y., Jin, J., Hu, Q., Zhou, H.M., Yi, J., Yu, Z., Xu, L., Wang, X., Yang, Y., and Loscalzo, J. (2011). Genetically encoded fluorescent sensors for intracellular NADH detection. Cell Metab 14, 555-566. Zhao, Y., Wang, A., Zou, Y., Su, N., Loscalzo, J., and Yang, Y. (2016). In vivo monitoring of cellular energy metabolism using SoNar, a highly responsive sensor for NAD(+)/NADH redox state. Nat Protoc 11, 1345-1359. Zhao, Y., Zhang, Z., Zou, Y., and Yang, Y. (2018). Visualization of nicotine adenine dinucleotide redox homeostasis with genetically encoded fluorescent sensors. Antioxid Redox Signal 28, 213-229. Zhou, T., Benda, C., Dunzinger, S., Huang, Y., Ho, J.C., Yang, J., Wang, Y., Zhang, Y., Zhuang, Q., Li, Y., et al. (2012). Generation of human induced pluripotent stem cells from urine samples. Nat Protoc 7, 2080-2089. 54 / 54 Zong, W.X., Ditsworth, D., Bauer, D.E., Wang, Z.Q., and Thompson, C.B. (2004). Alkylating DNA damage stimulates a regulated form of necrotic cell death. Genes Dev 18, 1272-1282. Zou, Y., Wang, A., Shi, M., Chen, X., Liu, R., Li, T., Zhang, C., Zhang, Z., Zhu, L., Ju, Z., et al. (2018). Analysis of redox landscapes and dynamics in living cells and in vivo using genetically encoded fluorescent sensors. Nat Protoc 13, 2362-2386. D E FA B CWavelength (nm)400 450 500 550 600Normalized Intensity0.00.20.40.60.81.01.2CTLNAD+Ex EmcpYFP cpYFP cpYFP cpYFPFiNadNA+DmCherry-FiNadT-Rex(190-211) cpYFPmCherry T-Rex(78-189)FiNad T-Rex(78-189)T-Rex(190-211)cpYFPT-Rex(1-77)T-Rex(1-77)NAD+NAD+/AXP ratio002468100.01 0.1 1 10 1000.2 mM AXP(ATP:ADP=100)1 mM AXP(ATP:ADP=100)5 mM AXP(ATP:ADP=100)Normalized FluorescenceLive-cell cytosolicNAD /NADH ratio+[NAD+]/[NADH]Normalized Fluorescence010 100 1000 10000246810 + 0.1 mM NAD+0.01 mM NAD10 mM NAD1 mM NAD++NAD+LiveCellLiveCellNADHNucleotide (μM)Normalized Fluorescence00246810120.1110 100 1000 10000NADHNAD+NADPHNADP+Concentration (μM)Normalized Green/Red0 10 100 1000 100000246810NAD+NANAMNMNNRFigure 1 1.01.50.5Green/Red RatioCTL NR 2-HNANAM NMNNAmCherry-FiNad0.51.00Green/Red RatiomCherry-cpYFPA B CNormalized Green/RedCTLNANAMNMNNR2-HNA0.00.40.81.21.62.0*********mCherry-FiNadNormalized Green/RedCTLNANAMNMNNR2-HNA0.00.40.81.21.62.0mCherry-cpYFPD E F103104103104103104103104103104103104103104103104103104103104103104103104RedGreenCTL NA NAM NMN NR 2-HNA1.00 1.08 1.10 1.41 1.45 0.77Normalized Green/RedCTLNANAMNMNNR2-HNA0.00.40.81.21.62.0************mCherry-FiNadNormalized Green/RedCTLNANAMNMNNR2-HNA0.00.40.81.21.62.0***********mCherry-FiNadBacterialcell wallBacterialcell membraneNANANAMNpncBNAADnadDNAMNAMNRNRNMNNAD+CytosolNMNNMNnadRpncApncCNADHGlycolysis ETCADPATPATPADPFigure 2 A B CD E F GNADHNAD+NMNNAMNMNNA NRNAMPT?MitochondriaNucleusTCACycle ETCCytosolNADHNAD+NMNNAM NAMPTNADHNAD+NMNNAM NAMPTGlycolysis LDHNA NRNAMNNAADNMNATExtracellular milieuPlasma membraneNAMNMNMetformin (mM)Normalized Green/Red0.00.5 1.01.5 2.00.80.91.01.11.2mCherry-FiNadmCherry-cpYFPADPATPADPATPMNNG0.751.50488/405 Ratio1.53.00488/405 RatioH I JNormalized Green/Red CTLApigeninEX527AZD2281AZD2461FK866MNNG0.00.20.40.60.81.01.21.4InhibitorCD38 SIRT1 PARP NAMPTPARPActivator*** ***** ***FiNadIn vivo imaging1.300Green/Red Ratio0.650.600.20Green/Red Ratio0.40mCherry -FiNadmCherry -cpYFPFK8660 h 2 h 4 h 6 h 8 h10 h 12 h 14 h 16 h 18 h0 h 2 h 4 h 6 h 8 h10 h 12 h 14 h 16 h 18 h1.300Green/Red Ratio0.650.750.15Green/Red Ratio0.45mCherry -FiNadmCherry -cpYFPAZD24610 h 1 h 2 h 3 h 4 h 5 h6 h 7 h 8 h 9 h 10 h 11 h0 h 1 h 2 h 3 h 4 h 5 h6 h 7 h 8 h 9 h 11 h10 hMNNGTime (mi n)R488/4050510 15 20 25 300.00.51.01.52.02.52 (iNapc)1 (iNapc)3 (iNapc)4 (iNapc)1 (FiNad)4(FiNad)3 (FiNad)2 (FiNad)Time (h)Green/Red Ratio0246810 120.50.60.70.80.91.0mCherry-cpYFPmCherry-FiNadAZD2461AZD2461FK866FK866Time (h)Green/Red Ratio10121416180.00.30.60.91.2mCherry-cpYFPmCherry-FiNad02468In vivoFiNadiNapc30 min20 min15 min10 min5 min2134120 min3214Figure 3 0.81.40.2Green/Red Ratio0.51.00CTL NRNAM NMNNAmCherry-FiNadmCherry-cpYFPD F0.61.20Green/Red RatiomCherry-FiNadmCherry-cpYFPCTL NRNAM NMNNANA (μM)01105FK866 (nM)0 10 100 500 2000NAM (μM) NMN (μM) NR (μM)Cell Survival (%)0100G H IGreen/RedRatioCTLNANAMNMNNR0.40.60.81.0********mCherry-FiNadGreen/RedRatioCTLNANAMNMNNR0.40.60.81.0mCherry-cpYFPFiNadElectroporationNAD precursorsIntraperitonealinjection6 daysMice (8 weeks)Fluorescence imaging+500 mg/kg/dayNormalized Green/Red CTLNANAMNMNNRCTLNANAMNMNNR0.40.60.81.01.21.4******FK866**********Green/RedRatio CTLNANAMNMNNR0.50.81.11.41.72.0*********00.20.5151020100500200000.20.515102010050020000.40.60.81.01.21.4FK866***A B C E0 10 100 500 2000 0 10 100 500 20000 10 100 500 200010 nM FK8660 nM FK866NA (μM)Normalized Green/Red CTL5 μM FK8661 μM FK86610 μM FK866mCherry-FiNadmCherry-FiNadmCherry-FiNadCTL10 mM NAM5 mM NAM20 mM NAMCTLNANMNNRmCherry-cpYFPmCherry-cpYFPmCherry-cpYFPCTL5 mMNAM10mMNAM20mMNAM5mM NA5mM NMN2mM NR1μMFK8665μMFK86610μMFK8660.00.30.60.91.2CTL5mMNAM10mMNAM20mMNAM5mMNA5mMNMN2mM NR1MFK8665MFK86610MFK8660.10.20.30.4******************mCherry-FiNadmCherry-cpYFPGreen/Red Ratio Green/Red Ratio0.05 0.3 0 1.2Green/Red Ratio Green/Red Ratio0.05 0.3 0 1.2Green/Red Ratio Green/Red Ratio0.05 0.3 0 1.2J K LM N OBacteriaMammalian CellsMiceZebrafishCTL NA NAM NMN NR1.01.5Normalized Green/RedGreen/Red Ratio Green/Red RatioFigure 4 Resting MacrophageSoNar-CTL488 nm103104105106405 nm103104105106SoNar-FK866Resting Macrophage405 nm103104105106488 nm103104105106Resting MacrophageSoNar-STF118804488 nm103104105106405 nm103104105106SoNar- CTLActivated Macrophage405 nm103104105106488 nm103104105106Activated MacrophageSoNar- FK866488 nm103104105106405 nm103104105106SoNar- STF118804Activated Macrophage405 nm103104105106488 nm103104105106RestingMacrophagemCherry-FiNad102103104105106103104105GreenRedResting MacrophagemCherry- cpYFPGreen102103104105106Red103104105ActivatedMacrophage102103104105106GreenRed103104105ActivatedMacrophageGreen102103104105106Red103104105Resting Activated iNOSNAMPTCTLFK866STF118804NMNAT2CTLFK866STF118804CD38PARP1SIRT2SIRT1Resting Activated CTLFK866STF118804CTLFK866STF118804PARβ-actinH2O2AZD2461Resting Activated CTLFK866STF118804CTLFK866STF118804β-actinGAPDH Relative NAMPTexpression A B CD E FG H I JK L M60 500 1000Count102103104105DAF-FM DA FluorescenceCTLFK866STF118804CTLFK866STF118804Resting ActivatedNormalized Green/Red RestingActivated0.80.91.01.11.2*mCherry-FiNadmCherry- cpYFPResting Macrophage Activated MacrophageGlucosePyruvateLactateLactateNADPHNAD+NADHGlucosePyruvateLactateLactateNADPHNAD+NADH L-arginineNONAMPTNAMPTTNFαIL-6superfolder GFP Fluorescence102103104105101106CTLFK866STF118804CTLFK866STF118804Resting Activated0 100 200CountRestingActivatediNOSNormalized R405/488 CTLFK866STF118804CTLFK866STF1188040.00.40.81.21.62.0RestingActivated*******SoNarNormalizedExtracellularLactateLevelCTLFK866STF118804CTLFK866STF118804012345RestingActivated*** ****DAF-FM DA FluorescenceCTLFK866STF118804CTLFK866STF118804010002000300040005000 *** ****IL-6 Level(pg/10cells)CTLFK866STF118804CTLFK866STF1188040200400600800RestingActivated*********(pg/106cells)TNFα LevelCTLFK866STF118804CTLFK866STF118804060012001800240030003600RestingActivated*** ******NormalizedPhagocytosis IndexCTLFK866STF118804CTLFK866STF118804012345Resting Activated******Figure 5 WT G3 TercReplicative senescence of human diploid fibroblastsSA-β- Gal-positive cells (%)P20 P30 0102030405060***0.350.70Green/Red Ratio2 months 24 monthsmCherry-FiNadmCherry-cpYFP0.30.60 0.651.00.3Green/Red RatioP20’ P30’mCherry-FiNadmCherry-cpYFP0.70.3Green/Red Ratio0.40.80Green/Red RatioWT 1.1mCherry-FiNadmCherry-cpYFPYoung (2 months) Aged (24 months)0.51.00Green/Red RatiomCherry-FiNadmCherry-cpYFP2 months 24 monthsA B C DE F G H IJ K L M NPrimarymyoblasts2 months0.20.40.60.81.0Green/Red Ratio**0.20.40.60.81.01.2Green/Red Ratio**WTG3 Terc0.20.40.60.81.01.21.41.6Green/RedRatio***0.00.30.60.91.2Green/Red Ratio***CCC-HPF-1Green/Red Ratio-/-mCherry-FiNadmCherry-cpYFPmCherry-FiNadmCherry-FiNadmCherry-FiNadmCherry-cpYFPmCherry-cpYFPmCherry-cpYFPPrimarycardiomyocytesPrimarymyoblastsG3 Terc-/-P20’ P30’P20 P30 P20 P30 0.40.60.81.0Green/Red Ratio***mCherry-FiNadmCherry-cpYFP-/-WTG3 Terc-/-WTG3 Terc-/-WTG3 Terc-/-24 months2 months24 months2 months24 months2 months24 monthsmCherry-FiNadmCherry-cpYFPmCherry-FiNadmCherry-cpYFPm 0.751.50Green/Red RatioYoungMiddle-agedO P QYoung AdultsMiddle-aged AdultsUrinesamples500 g, 10 min, RTDiscard the supernatant500 g, 10 min, RTDiscard the supernatant Seed into gelatin-coated6-well plate, culture for 7 daysRemove unadherent cellsPick out coloniesMulti-well glass-bottom plate35-mm culture dish50 μmFluorescenceimagingAdenovirusinfectionWashwithPBSResuspandw ithhUSC media Volunteer 1 Volunteer 2 Volunteer 3Volunteer 4 Volunteer 5 Volunteer 6Age 24 Age 24 Age 27Age 40 Age 46 Age 56Green/Red Ratio0.51.01.52.0hUSC-mCherry-FiNad*Volunteer 1Volunteer 2Volunteer 3Volunteer 4Volunteer 5Volunteer 6Young Middle-agedG3 Terc-/-Muscle tissues0.751.50Green/Red RatioWTmCherry-FiNadmCherry-cpYFPMuscle tissuesFigure 6 1 / 17 Supplemental Information Illuminating NAD+ Metabolism in Live Cells and In Vivo Using a Genetically Encoded Fluorescent Sensor Inventory of Supplemental information: Supplemental Data 1) Figure S1. Related to Figure 1. 2) Table S1 and Table S2. Related to Figure 1. 3) Figure S2. Related to Figure 2. 4) Figure S3. Related to Figure 3. 5) Figure S4. Related to Figure 4. 6) Table S3. Related to Figure 2, Figure 4. 7) Figure S5. Related to Figure 5. 8) Figure S6. Related to Figure 6. 3 / 17 Figure S1, related to Figure 1. (A) The screening workflow for FiNad sensor. (B) Molecular organization and amino acid sequences of FiNad sensor. FiNad is designed by inserting cpYFP between residues 189 and 190 of the T-Rex monomer with the short oligopeptide linkers G and GTG. (C) Fluorescence intensities of FiNad with excitation at 485 nm or 420 nm in the presence of different concentrations of NAD+, and emission at 528 nm. Data are normalized to the fluorescence in the absence of NAD+ (n=3). (D) Fluorescence intensities of FiNad with excitation at 485 nm in the presence of different concentrations of NAD+ and its analogs, normalized to the initial value(n=3). (E) FiNad fluorescence plotted against NAD+ with or without 1 mM ATP or ADP, normalized to the initial value (n=3). (F-H) FiNad fluorescence plotted against ATP (F), ADP (G), or AXP (H, ATP:ADP=100:1) at the indicated NAD+ concentration, normalized to the fluorescence in the absence of NAD+ (n=3). (I-K) FiNad fluorescence plotted against NAD+/ATP ratio (I), NAD+/ADP ratio (J), or NAD+/AMP ratio (K) at the indicated total adenine nucleotide concentration (n=3). Data are normalized to the fluorescence in the absence of NAD+ (1 mM AXP). (L) FiNad fluorescence plotted against NAD+ in the presence of 0.1 mM NADP+ or NADPH, normalized to the initial value (n=3). (M) FiNad fluorescence plotted against NAD+ at the indicated ATP:ADP ratios of physiological conditions (n=3); the total adenine nucleotide concentration was 1 mM. (N) Fluorescence spectra of purified mCherry-FiNad in the control condition (dark red), and with saturating NAD+ concentration (orange). The excitation spectrum recorded at an emission wavelength of 615 nm has a maximum at 587 nm; the emission spectrum recorded at an excitation wavelength of 580 nm has a maximum at 610 nm. (O and P) The excitation ratio Green/Red of mCherry-FiNad plotted against NAD+ in the presence of 0.5 mM NAD+ precursors (O, n=3) and 2 or 5 mM precursors (P, n=3). (Q) R485/420 of LigA-cpVenus towards different concentrations of NAD+ or its precursors (n=3). (R and S) R485/420 of LigA-cpVenus plotted against NAD+ in the presence of 0.5 mM precursors (R) and 2 or 5 mM precursors (S) (n=3). (T) Fluorescence intensities of mCherry-FiNad and mCherry-cpYFP with excitation at 485 nm 4 / 17 (green) or 590 nm (red), and emission at 528 nm or 645 nm, respectively. Data are normalized to the fluorescence at pH 7.4 (n=3). (U and V) Un-normalized (U) and normalized (V) Green/Red ratio of mCherry-FiNad plotted against NAD+ at the indicated pH (n=3). (W) pH-dependence of the excitation ratio Green/Red of mCherry-FiNad and mCherry-cpYFP. Data are normalized to the fluorescence at pH 7.4 (n=3). (X) Fluorescence response of mCherry-FiNad to 50 mM NAD+ at various temperatures (n=3). Data are normalized to the fluorescence in the absence of NAD+. Data are presented as the mean ± s.d. 6 / 17 Figure S2, related to Figure 2. (A and B) Cellular NAD+ (A, n=4) or AXP pool (B, n=3) measured by a biochemical assay in E. coli BL21 (DE3) cells treated with NAD+ precursors or the pncB inhibitor 2-HNA. (C and D) Fluorescence response of LigA-cpVenus (C, n=3), and cpVenus (D, n=3) in E. coli BL21 (DE3) cells treated with NAD+ precursors or the pncB inhibitor 2-HNA. (E) Flow cytometric analyses of mCherry-cpYFP fluorescence in live E. coli treated with NAD+ precursors or the pncB inhibitor 2-HNA. (F) Quantification of mCherry-cpYFP fluorescence in panel E (n=4). Data are the mean ± s.e.m, normalized to the control condition in the absence of compounds (A, B, C, D, F). All P values were obtained using unpaired two-tailed Student’ s t tests. ***P 0.001. 8 / 17 Figure S3, related to Figure 3. (A) Ratiometric fluorescence images of HEK293 cells expressing mCherry-FiNad in the cytosol and nucleus, with pseudocolored pixel-by-pixel green-to-red ratio images. Scale bar, 10 μm. (B) Effect of rotenone and pyruvate on fluorescence ratios of cells expressing mCherry-FiNad or SoNar. HEK293 cells were treated with compounds for 5 min (n=3). (C) Kinetics of mCherry-FiNad and PercevalHR (ADP/ATP ratio sensor) fluorescence responses in HEK293 cells treated with rotenone and oligomycin (n=3). (D) Fluorescence images of mCherry-FiNad or mCherry-cpYFP in HEK293 cells treated with AZD2461 or FK866, scale bar, 10 μm. (E) Quantification of mCherry-FiNad fluorescence corrected by mCherry-cpYFP in panel D (n=10, 10, 12). (F) Effect of different concentrations of NAMPT inhibitor (FK866) on cellular NAD+ pool, AXP pool, NAD+/AXP ratio, and mCherry-FiNad (n=5). (G) Fluorescence images of mCherry-FiNad or mCherry-cpYFP in HEK293 cells treated with 20 μM MNNG, scale bars, 10 µm. (H) Effect of different concentrations of PARP activator (MNNG) on cellular NAD+ pool, AXP pool, NAD+/AXP ratio, and mCherry-FiNad (n=3). (I and J) Fluorescence images (I) and quantification (J) of mCherry-FiNad in ex vivo muscle tissues upon MNNG treatment indicating regions of interest (white dashed line). Scale bars, 100 µm. (K and L) Effect of CD38 inhibitor (Apigenin), SIRT1 inhibitor (EX527), PARP inhibitors (AZD2281; AZD2461), NAMPT inhibitor (FK866), and PARP activator (MNNG) on cellular NAD+ (K) or AXP pool (L) measured by a biochemical assay (n=3). (M) Effect of metformin on cellular NAD+ or AXP pool measured by a biochemical assay (n=3). (N and O) Fluorescence images (N) and quantification (O) of mCherry-FiNad (n=28, 16, 10) or mCherry-cpYFP (n=7, 12, 6) in the nucleus of HEK293 cells treated with AZD2461 or AZD2281, scale bar 10 μm. Data are the mean ± s.e.m (B, C, F, H, K, L, M) or mean ± s.d. (E, O), normalized to the control condition in the absence of compounds (B, C, F, H, K, L, M). All P values were obtained using unpaired two-tailed Student’s t tests. ***P 0.001. 10 / 17 Figure S4, related to Figure 4. (A and B) Quantification (n=25) of mCherry-FiNad (A) or mCherry-cpYFP (B) in panel Figure 4A. (C and D) Effect of NAD+ precursors on cellular NAD+ (C) or AXP pool (D)(n=3). (E) Effect of different concentrations of NAD+ precursors on NAMPT inhibitor FK866-triggered cell death. HEK293 cells were treated for 48 h (n=6). (F and G) Effect of NAD+ precursors on total NAD+ (F) or AXP pool (G) in muscle tissues of mice (n=12). Male mice at 8 weeks of age were given intraperitoneal injections of vehicle control, NA, NAM, NMN, or NR (500 mg/kg/day) for 6 days. (H-J) In vivo fluorescence imaging (H) and quantification (I, n=8, 7, 7, 9; J, n=8, 12, 9, 11) of pre-hatched zebrafish embryos expressing mCherry-FiNad or mCherry-cpYFP treated with different concentrations of FK866 indicating regions of interest (white dashed line), scale bars, 100 μm. (K and L) Effect of NAD+ precursors or FK866 on total NAD+ (K) or AXP pool (L) in zebrafish larvae (n=6). Zebrafish larvae were treated for 24 h. Data are the mean ± s.e.m (C, D, E, F, G, K, L) or mean ± s.d. (A, B, I, J), normalized to the control condition in the absence of compounds (C, D, F, G, K, L). All P values were obtained using unpaired two-tailed Student’s t tests. *P 0.05, **P 0.01, ***P 0.001. 12 / 17 Figure S5, related to Figure 5. (A) mCherry-FiNad (left) and mCherry-cpYFP (right) fluorescence in resting or activated RAW264.7 mouse macrophages measured by flow cytometry (n=3). (B) Fluorescence images of mCherry-FiNad or mCherry-cpYFP in resting or activated RAW264.7 mouse macrophages, scale bar, 10 μm. (C) Quantification of mCherry-FiNad fluorescence corrected by mCherry-cpYFP in panel B; data are presented as the mean ± s.d (n=10, 9). (D and E) Total NAD+ level, AXP level (D), or NAD+/AXP ratio (E) in resting or activated RAW264.7 mouse macrophages measured by biochemical analysis (n=9). (F-H) Effect of NAMPT inhibitors, FK866 or STF118804, on SoNar (F, n=3) and iNapc fluorescence (G, H, n=3). (I-L) Effect of iNOS inhibitor, L-NAME, on cytosolic NADPH level of glucose-fed (I, J, n=3) or glucose-deprived (K, L, n=3) cells in resting or activated RAW264.7 mouse macrophages. (M) Immunoblots for enzymes associated with NADPH consumption (iNOS, FASN, GSR) and NADPH synthesis (MTHFD1, G6PD, PGD, ME1, and IDH1) in resting or activated RAW264.7 cells treated with iNOS inhibitor, L-NAME. iNOS, inducible nitric oxide synthase; FASN, fatty acid synthase; GSR, glutathione reductase; MTHFD1, methylene tetrahydrofolate dehydrogenase 1; G6PD, glucose-6-phosphate dehydrogenase; PGD, 6-phosphogluconate dehydrogenase; ME1, malic enzyme 1; IDH1, isocitrate dehydrogenase 1. (N-Q) Effect of iNOS inhibitor, L-NAME, on nitric oxide production measured by DAF-FM DA fluorescence (N, O, n=3), production of proinflammatory cytokine (TNFα, P, n=3), and phagocytosis efficiency (Q, n=3) in resting or activated RAW264.7 mouse macrophages. Data are the mean ± s.e.m (A, D, E, F, H, J, L, O, P, Q), normalized to the control condition in the absence of compounds (A, C, D, F, H, J, L, Q). All P values were obtained using unpaired two-tailed Student’s t tests. *P 0.05, **P 0.01, ***P 0.001. 14 / 17 Figure S6, related to Figure 6. (A) Electrophoresis images for the genotype of telomerase-deficient (G3Terc-/-, G3) mice. L, DNA ladder; HET, heterozygote; KO, Terc knockout; WT, wild type. (B and C) Fluorescence images (B) and quantification (C, n=50) of mCherry-cpYFP in human urine-derived stem cells (hUSC) at different ages. Images are pseudocolored by R488/561. Scale bars, 10 µm. (D-J) Total NAD+ or AXP pool measured by a biochemical assay in CCC-HPF-1 (D, n=4) at late passages (P20, P30), in primary myoblasts (E, n=5) and primary cardiomyocytes (F, n=6) freshly isolated from aged mice (~24 months) or young mice (~2 months), in muscle tissues of mice (G, n=6) and primary myoblasts (H, n=5) freshly isolated from 10-month-old WT and the third generation of telomerase-deficient (G3Terc-/-, G3) mice, and in human urine-derived stem cells (hUSC) at different ages (I, J, n=6). (K) Cellular NAD+/AXP ratio in hUSC at different ages (n=6), with data from panel I and J. Data are the mean ± s.e.m (D, E, F, G, H, I, J, K) or mean ± s.d. (C). All P values were obtained using unpaired two-tailed Student’s t tests. *P 0.05, **P 0.01, ***P 0.001. 15 / 17 Table S1, related to Figure 1 | Primers used for FiNad cloning and sequencing. Recombinant DNA Primer sequences for cloning Primer sequences for sequencing pCDFDuet-FiNad Forward1: TACAACAGCGACAACGTCTATATC Forward: TAATACGACTCACTATAGGG Reverse1: GTTGTACTCCAGCTTGTGCCCCAG Reverse: TGCTAGTTATTGCTCAGCGG Forward2: CACAAGCTGGAGTACAACGGTACCGGCCTGGCCGGCCTGACCCGGCTG Reverse2: GACGTTGTCGCTGTTGTAGCCGAAGTCCACGTTCTCCACGGCC pCDFDuet-mCherry-FiNad Forward: CCCGGATCCGATGGTGAGCAAGGGCGAGGAGG Forward: TAATACGACTCACTATAGGG Reverse: CCCGAATTCCTTGTACAGCTCGTCCATGCCG Reverse: TGCTAGTTATTGCTCAGCGG pCDFDuet-mCherry-cpYFP Forward：CCCGAATTCTACAACAGCGACAACGTCTATATC Forward: TAATACGACTCACTATAGGG Reverse: GGGCTCGAGTTAGTTGTACTCCAGCTTGTGCCC Reverse: TGCTAGTTATTGCTCAGCGG pLVX-mCherry-FiNad Forward: CCCCTCGAGCACCATGGTGAGCAAGGGCGAGGAGGAT Forward: CGCAAATGGGCGGTAGGCGTG Reverse: GAGTCTAGACCGCTTCGTTCTACCTAGCCCATCATCTCCTCCCGCC Reverse： CCTCACATTGCCAAAAGACG pLVX-mCherry-cpYFP Forward: CCCCTCGAGCACCATGGTGAGCAAGGGCGAGGAGGAT Forward: CGCAAATGGGCGGTAGGCGTG Reverse: CCCTCTAGATTAGTTGTACTCCAGCTTGTG Reverse： CCTCACATTGCCAAAAGACGS pcDNA3.1-FiNad Forward: CCCGGATCCGATGAAGGTGCCCGAGGCCGCCAT Forward: CGCAAATGGGCGGTAGGCGTG Reverse: GGGCTCGAGCTAGCCCATCATCTCCTCCCGCCAC Reverse: TAGAAGGCACAGTCGAGG pcDNA3.1-mCherry-FiNad Forward: CCCGGATCCGATGGTGAGCAAGGGCGAGGAGG Forward: CGCAAATGGGCGGTAGGCGTG Reverse: GGGCTCGAGCTAGCCCATCATCTCCTCCCGCCAC Reverse: TAGAAGGCACAGTCGAGG pcDNA3.1-mCherry-cpYFP Forward: CCCGGATCCGATGGTGAGCAAGGGCGAGGAGG Forward: CGCAAATGGGCGGTAGGCGTG Reverse: GGGCTCGAGTTAGTTGTACTCCAGCTTGTGCCC Reverse: TAGAAGGCACAGTCGAGG 16 / 17 Table S2, related to Figure 1 | Comparison of NAD+ sensors FiNad and LigA-cpVenus. Properties FiNad LigA-cpVenus (Science 2016, 352, 1474) Specific Comments Sensor origin and fluorescent protein Rex protein from Thermus aquaticus and cpYFP Bacterial DNA ligase and cpVenus Two sensors with different design. Physiological signal sensed NAD+ NAD+, NR, NMN The lack of specificity of LigA-cpVenus complicates live-cell or in vivo studies of NAD+ metabolism. Response to NAD+ in the presence of pharmaceutical concentrations of NR or NMN Yes No LigA-cpVenus no longer responds to NAD+ fluctuation in cells treated with pharmacological concentrations of NR, NMN. Dynamic response (F/F) 700% increase in fluorescence 50% decrease in fluorescence Higher dynamic range allows observation of subtle changes. Affinity for physiological levels of NAD+ In range (~1.3 mM) High (~65 μM) LigA-cpVenus appears to be almost fully saturated by physiological NAD+ levels. Response to increases and decreases in NAD+ Yes No LigA-cpVenus seems only to respond to decreases in NAD+ in most cases. Two-channel ratiometric sensing Yes Yes Studies in bacteria Yes No It may be helpful for investigating the roles of NAD+ in gut microflora and microbial engineering. Validated in vivo Yes No Compatibility of high-throughput screening for NAD+-boosting molecules Yes No NAD+-enhancing molecules may be useful against aging and chronic diseases. Desired properties labeled as blue, unfavorable properties labeled as orange 17 / 17 Table S3, related to Figure 2, Figure 4. | A head-to-head comparison study of four common NAD+ precursors in enhancing NAD+ levels in different species. CTL NA NAM NMN NR Bacteria 1.0 ~1.09 ~1.09 ~1.42 ~1.50 Mammalian cells 1.0 ~1.0 ~1.24 ~1.25 ~1.25 Mice 1.0 ~1.07 ~1.37 ~1.37 ~1.33 Zebrafish larvae 1.0 ~1.0 ~1.27 ~1.0 ~1.0 Data are normalized to control and calculated from quantification of mCherry-FiNad fluorescence corrected by mCherry-cpYFP in Figure 2 and Figure 4. Citations (17)References (58)... Accordingly, restoration of NAD + via precursors may reestablish the NADH/ NAD + ratio, thereby reducing the cardiovascular injuries and attenuating cell senescence. [361][362][363] Indeed, mounting studies have shown the influence of exogenous NAD + repletion in the regulation and homeostasis in different models (gut, heart, muscle, etc.). [364][365][366][367][368][369] A recent study shows augmented circulating α-hydroxybutyrate levels associated with increased NADH/NAD + ratio and impaired glucose metabolism, 370 while a normalized NADH/NAD + ratio can achieve by constructing LOXCAT-mediated conversion of lactic acid to pyruvate. ...... Genetically encoded fluorescent probes represent promising tools to realize high-dynamic, high-resolution, high-throughput NADH/NAD + detection in vivo, empowering a real-time visualization of compartmentalized NAD + that facilitate screening for NAD-associated drug design or gene candidates identification. 363,374 Furthermore, manipulation of melatonin, 555 supplementation of compounds, such as spermidine, 556 acarbose, 557 and urolithin A 514 may also exert an anti-ageing effect through metabolic remodeling. Intriguingly, a controversial study using parabiosis demonstrated that the enhanced level or administration of GDF11 could correct DNA damage accumulated in ageing mouse satellite cells, 558 while its paralog myostatin regulates energy homeostasis in the heart and prevents heart failure. ...Inflammation, epigenetics, and metabolism converge to cell senescence and ageing: the regulation and interventionArticleFull-text availableJun 2021Xudong Zhu Zhiyang ChenWeiyan ShenZhenyu JuRemarkable progress in ageing research has been achieved over the past decades. General perceptions and experimental evidence pinpoint that the decline of physical function often initiates by cell senescence and organ ageing. Epigenetic dynamics and immunometabolic reprogramming link to the alterations of cellular response to intrinsic and extrinsic stimuli, representing current hotspots as they not only (re-)shape the individual cell identity, but also involve in cell fate decision. This review focuses on the present findings and emerging concepts in epigenetic, inflammatory, and metabolic regulations and the consequences of the ageing process. Potential therapeutic interventions targeting cell senescence and regulatory mechanisms, using state-of-the-art techniques are also discussed.ViewShow abstract... Nevertheless, no biosensing systems are reported for NMN. On the other hand, such invivo and in-vitro biosensors have been recently developed for NAD, providing a powerful tool for studying its role in cellular and extracellular microenvironment [21][22][23][24]. Development of a biosensor able to quantify NMN in subcellular compartments and biological fluids would help to clarify several aspects of NMN homeostasis and contribute to shedding light on the mechanisms of its pharmacological action. ...... Examples of these biosensors have been recently reported for the NAD detection. They are based on NAD-binding domains of bacterial enzymes as MREs, fused to circularly permuted fluorescent proteins [22][23][24]. ...Characterization of Two NMN Deamidase Mutants as Possible Probes for an NMN BiosensorArticleFull-text availableJun 2021INT J MOL SCIAlessandra CamarcaGabriele Minazzato Angela Pennacchio Nadia RaffaelliNicotinamide mononucleotide (NMN) is a key intermediate in the nicotinamide adenine dinucleotide (NAD+) biosynthesis. Its supplementation has demonstrated beneficial effects on several diseases. The aim of this study was to characterize NMN deamidase (PncC) inactive mutants to use as possible molecular recognition elements (MREs) for an NMN-specific biosensor. Thermal stability assays and steady-state fluorescence spectroscopy measurements were used to study the binding of NMN and related metabolites (NaMN, Na, Nam, NR, NAD, NADP, and NaAD) to the PncC mutated variants. In particular, the S29A PncC and K61Q PncC variant forms were selected since they still preserve the ability to bind NMN in the micromolar range, but they are not able to catalyze the enzymatic reaction. While S29A PncC shows a similar affinity also for NaMN (the product of the PncC catalyzed reaction), K61Q PncC does not interact significantly with it. Thus, PncC K61Q mutant seems to be a promising candidate to use as specific probe for an NMN biosensor.ViewShow abstract... The lack of effective in vitro and in vivo models of mitochondrial DNA mutation has hampered mechanistic studies [35]. The traditional cytoplasmic hybrid (cybrid) cell lines [36] or human induced pluripotent stem (hiPS) cells were either artificial or laborious to generate [15,37,38]. HiPS cells often carry additional genetic and mitochrondral mutations created during the induction process [39,40]. ...ATF5, a putative therapeutic target for the mitochondrial DNA 3243A G mutation-related diseaseArticleFull-text availableJul 2021Xinpei GaoZhixin JiangXinfeng Yan Congrong WangThe mitochondrial DNA m.3243A G mutation is well-known to cause a variety of clinical phenotypes, including diabetes, deafness, and osteoporosis. Here, we report isolation and expansion of urine-derived stem cells (USCs) from patients carrying the m.3243A G mutation, which demonstrate bimodal heteroplasmy. USCs with high levels of m.3243A G mutation displayed abnormal mitochondrial morphology and function, as well as elevated ATF5-dependent mitochondrial unfolded protein response (UPR mt ), together with reduced Wnt/β-catenin signaling and osteogenic potentials. Knockdown of ATF5 in mutant USCs suppressed UPR mt , improved mitochondrial function, restored expression of GSK3B and WNT7B , and rescued osteogenic potentials. These results suggest that ATF5-dependent UPR mt could be a core disease mechanism underlying mitochondrial dysfunction and osteoporosis related to the m.3243A G mutation, and therefore could be a novel putative therapeutic target for this genetic disorder.ViewShow abstract... Several genetically encoded sensors able to detect the NADH/NAD + ratio in living cells have been reported [204,205], but the absolute quantification of NAD + has only recently been obtained by Cambronne et al. [206] who reported a radiometric sensor based on bacterial DNA-ligase and cpVenusFP (LigA-cpVenus), showing fluorescence reduction upon NAD + binding. Very recently, Zou et al. [207] managed to obtain a sensor lighting in response to NAD + (FiNAD). FiNad is based on the insertion of cpYFP into the NAD + /NADH binding domain of the bacterial transcription repressor protein (T-Rex), optimized in order to recognize specifically NAD + . ...Emergent Biosensing Technologies Based on Fluorescence Spectroscopy and Surface Plasmon ResonanceArticleFull-text availableJan 2021SENSORS-BASELAlessandra Camarca Antonio Varriale Alessandro CapoMaria StaianoThe purpose of this work is to provide an exhaustive overview of the emerging biosensor technologies for the detection of analytes of interest for food, environment, security, and health. Over the years, biosensors have acquired increasing importance in a wide range of applications due to synergistic studies of various scientific disciplines, determining their great commercial potential and revealing how nanotechnology and biotechnology can be strictly connected. In the present scenario, biosensors have increased their detection limit and sensitivity unthinkable until a few years ago. The most widely used biosensors are optical-based devices such as surface plasmon resonance (SPR)-based biosensors and fluorescence-based biosensors. Here, we will review them by highlighting how the progress in their design and development could impact our daily life.ViewShow abstract... In addition to Ca 2+ sensors, cpFP-based sensors to detect cofactors [94], cAMP [95], ATP [96,97], or neurotransmitters such as glutamate and GABA [98,99] were developed by inserting specific sensing domains to cp-FP. Different from these cytosolic cpFP-based sensors detecting diffusible signaling molecules, the cpFP-based voltage sensor, named ASAP, was designed by fusion of cpFP module to voltage-sensing domains tethered at plasma-membrane [100,101]. ...Genetically Encoded Biosensors Based on Fluorescent ProteinsArticleFull-text availableJan 2021SENSORS-BASELHyunbin KimJeongmin JuHae Nim Lee Jihye SeongGenetically encoded biosensors based on fluorescent proteins (FPs) allow for the real-time monitoring of molecular dynamics in space and time, which are crucial for the proper functioning and regulation of complex cellular processes. Depending on the types of molecular events to be monitored, different sensing strategies need to be applied for the best design of FP-based biosensors. Here, we review genetically encoded biosensors based on FPs with various sensing strategies, for example, translocation, fluorescence resonance energy transfer (FRET), reconstitution of split FP, pH sensitivity, maturation speed, and so on. We introduce general principles of each sensing strategy and discuss critical factors to be considered if available, then provide representative examples of these FP-based biosensors. These will help in designing the best sensing strategy for the successful development of new genetically encoded biosensors based on FPs.ViewShow abstractNeurotransmitters responsible for purinergic motor neurotransmission and regulation of GI motilityArticleJun 2021AUTON NEUROSCI-BASICKenton M. Sanders Violeta N Mutafova-YambolievaClassical concepts of peripheral neurotransmission were insufficient to explain enteric inhibitory neurotransmission. Geoffrey Burnstock and colleagues developed the idea that ATP or a related purine satisfies the criteria for a neurotransmitter and serves as an enteric inhibitory neurotransmitter in GI muscles. Cloning of purinergic receptors and development of specific drugs and transgenic mice have shown that enteric inhibitory responses depend upon P2Y1 receptors in post-junctional cells. The post-junctional cells that transduce purinergic neurotransmitters in the GI tract are PDGFRα⁺ cells and not smooth muscle cells (SMCs). PDGFRα⁺ cells express P2Y1 receptors, are activated by enteric inhibitory nerve stimulation and generate Ca²⁺ oscillations, express small-conductance Ca²⁺-activated K⁺ channels (SK3), and generate outward currents when exposed to P2Y1 agonists. These properties are consistent with post-junctional purinergic responses, and similar responses and effectors are not functional in SMCs. Refinements in methodologies to measure purines in tissue superfusates, such as high-performance liquid chromatography (HPLC) coupled with etheno-derivatization of purines and fluorescence detection, revealed that multiple purines are released during stimulation of intrinsic nerves. β-NAD⁺ and other purines, better satisfy criteria for the purinergic neurotransmitter than ATP. HPLC has also allowed better detection of purine metabolites and coupled with isolation of specific types of post-junctional cells has provided new concepts about deactivation of purine neurotransmitters. In spite of steady progress, many unknowns about purinergic neurotransmission remain and require additional investigation to understand this important regulatory mechanism in GI motility.ViewShow abstractSingle-cell resolved imaging reveals intra-tumor heterogeneity in glycolysis, transitions between metabolic states, and their regulatory mechanismsArticleFull-text availableFeb 2021Hiroshi Kondo Colin Ratcliffe Steven HooperErik SahaiInter-cellular heterogeneity in metabolic state has been proposed to influence many cancer phenotypes, including responses to targeted therapy. Here, we track the transitions and heritability of metabolic states in single PIK3CA mutant breast cancer cells, identify non-genetic glycolytic heterogeneity, and build on observations derived from methods reliant on bulk analyses. Using fluorescent biosensors in vitro and in tumors, we have identified distinct subpopulations of cells whose glycolytic and mitochondrial metabolism are regulated by combinations of phosphatidylinositol 3-kinase (PI3K) signaling, bromodomain activity, and cell crowding effects. The actin severing protein cofilin, as well as PI3K, regulates rapid changes in glucose metabolism, whereas treatment with the bromodomain inhibitor slowly abrogates a subpopulation of cells whose glycolytic activity is PI3K independent. We show how bromodomain function and PI3K signaling, along with actin remodeling, independently modulate glycolysis and how targeting these pathways affects distinct subpopulations of cancer cells.ViewShow abstractDual-modal imaging with non-contact photoacoustic microscopy and fluorescence microscopyArticleFeb 2021OPT LETTJiasheng ZhouWei WangLili Jing Sung-Liang ChenSimultaneous imaging of complementary absorption and fluorescence contrasts with high spatial resolution is useful for biomedical studies. However, conventional dual-modal photoacoustic (PA) and fluorescence imaging systems require the use of acoustic coupling media due to the contact operation of PA imaging, which causes issues and complicates the procedure in certain applications such as cell imaging and ophthalmic imaging. We present a novel dual-modal imaging system which combines non-contact PA microscopy (PAM) based on PA remote sensing and fluorescence microscopy (FLM) into one platform. The system enables high lateral resolution of 2 and 2.7 µm for PAM and FLM modes, respectively. In vivo imaging of a zebrafish larva injected with a rhodamine B solution is demonstrated, with PAM visualizing the pigment and FLM revealing the injected rhodamine B.ViewShow abstractNAD+ and Cardiovascular DiseasesArticleJan 2021CLIN CHIM ACTAQiuzhen LinWanyun Zuo Yaozhong Liu Qiming LiuNicotinamide adenine dinucleotide (NAD) plays pivotal roles in controlling many biochemical processes. ‘NAD’ refers to the chemical backbone irrespective of charge, whereas ‘NAD⁺’ and ‘NADH’ refers to oxidized and reduced forms, respectively. NAD⁺/NADH ratio is essential for maintaining cellular reduction–oxidation (redox) homeostasis and for modulating energy metabolism. As a sensing or consuming enzyme of the poly (ADP-ribose) polymerase 1 (PARP1), the cyclic ADP-ribose (cADPR) synthases (CD38 and CD157), and sirtuin protein deacetylases (sirtuins, SIRTs), NAD⁺ participates in several key processes in cardiovascular disease. For example, NAD⁺ protects against metabolic syndrome, heart failure, ischemia-reperfusion (IR) injury, arrhythmia and hypertension. Accordingly, the subsequent loss of NAD⁺ in aging or during stress results in altered metabolic status and potentially increased disease susceptibility. Therefore, it is essential to maintain NAD⁺ or reduce loss in the heart. This review focuses on the involvement of NAD⁺ in the pathogenesis of cardiovascular disease and explores the effects of NAD⁺ boosting strategies in cardiovascular health.ViewShow abstractConsiderations for using isolated cell systems to understand cardiac metabolism and biologyArticleDec 2020J MOL CELL CARDIOL Tariq AltamimiLindsey A. McNallyKyle Fulghum Bradford G HillChanges in myocardial metabolic activity are fundamentally linked to cardiac health and remodeling. Primary cardiomyocytes, induced pluripotent stem cell-derived cardiomyocytes, and transformed cardiomyocyte cell lines are common models used to understand how (patho)physiological conditions or stimuli contribute to changes in cardiac metabolism. These cell models are helpful also for defining metabolic mechanisms of cardiac dysfunction and remodeling. Although technical advances have improved our capacity to measure cardiomyocyte metabolism, there is often heterogeneity in metabolic assay protocols and cell models, which could hinder data interpretation and discernment of the mechanisms of cardiac (patho)physiology. In this review, we discuss considerations for integrating cardiomyocyte cell models with techniques that have become relatively common in the field, such as respirometry and extracellular flux analysis. Furthermore, we provide overviews of metabolic assays that complement XF analyses and that provide information on not only catabolic pathway activity, but biosynthetic pathway activity and redox status as well. Cultivating a more widespread understanding of the advantages and limitations of metabolic measurements in cardiomyocyte cell models will continue to be essential for the development of coherent metabolic mechanisms of cardiac health and pathophysiology.ViewShow abstractShow moreMast Cell-Derived Histamine Regulates Liver Ketogenesis via Oleoylethanolamide SignalingArticleFull-text availableOct 2018CELL METAB Alessandra Misto Gustavo Provensi Valentina Vozella Daniele PiomelliThe conversion of lipolysis-derived fatty acids into ketone bodies (ketogenesis) is a crucial metabolic adaptation to prolonged periods of food scarcity. The process occurs primarily in liver mitochondria and is initiated by fatty-acid-mediated stimulation of the ligand-operated transcription factor, peroxisome proliferator-activated receptor-α (PPAR-α). Here, we present evidence that mast cells contribute to the control of fasting-induced ketogenesis via a paracrine mechanism that involves secretion of histamine into the hepatic portal circulation, stimulation of liver H1 receptors, and local biosynthesis of the high-affinity PPAR-α agonist, oleoylethanolamide (OEA). Genetic or pharmacological interventions that disable any one of these events, including mast cell elimination, deletion of histamine- or OEA-synthesizing enzymes, and H1 blockade, blunt ketogenesis without affecting lipolysis. The results reveal an unexpected role for mast cells in the regulation of systemic fatty-acid homeostasis, and suggest that OEA may act in concert with lipolysis-derived fatty acids to activate liver PPAR-α and promote ketogenesis.ViewShow abstractAnalysis of redox landscapes and dynamics in living cells and in vivo using genetically encoded fluorescent sensorsArticleFull-text availableSep 2018NAT PROTOCYejun Zou Aoxue WangMei Shi Yuzheng ZhaoCellular oxidation-reduction reactions are mainly regulated by pyridine nucleotides (NADPH/NADP+ and NADH/NAD+), thiols, and reactive oxygen species (ROS) and play central roles in cell metabolism, cellular signaling, and cell-fate decisions. A comprehensive evaluation or multiplex analysis of redox landscapes and dynamics in intact living cells is important for interrogating cell functions in both healthy and disease states; however, until recently, this goal has been limited by the lack of a complete set of redox sensors. We recently reported the development of a series of highly responsive, genetically encoded fluorescent sensors for NADPH that substantially strengthen the existing toolset of genetically encoded sensors for thiols, H2O2, and NADH redox states. By combining sensors with unique spectral properties and specific subcellular targeting domains, our approach allows simultaneous imaging of up to four different sensors. In this protocol, we first describe strategies for multiplex fluorescence imaging of these sensors in single cells; then we demonstrate how to apply these sensors to study changes in redox landscapes during the cell cycle, after macrophage activation, and in living zebrafish. This approach can be adapted to different genetically encoded fluorescent sensors and various analytical platforms such as fluorescence microscopy, high-content imaging systems, flow cytometry, and microplate readers. A typical preparation of cells or zebrafish expressing different sensors takes 2-3 d; microscopy imaging or flow-cytometry analysis can be performed within 5-60 min.ViewShow abstractDe novo NAD+ biosynthetic impairment in acute kidney injury in humansArticleFull-text availableSep 2018Nat Med Ali poyan mehrMei T. Tran Kenneth Ralto Samir M ParikhNicotinamide adenine dinucleotide (NAD+) extends longevity in experimental organisms, raising interest in its impact on human health. De novo NAD+ biosynthesis from tryptophan is evolutionarily conserved yet considered supplanted among higher species by biosynthesis from nicotinamide (NAM). Here we show that a bottleneck enzyme in de novo biosynthesis, quinolinate phosphoribosyltransferase (QPRT), defends renal NAD+ and mediates resistance to acute kidney injury (AKI). Following murine AKI, renal NAD+ fell, quinolinate rose, and QPRT declined. QPRT+/- mice exhibited higher quinolinate, lower NAD+, and higher AKI susceptibility. Metabolomics suggested an elevated urinary quinolinate/tryptophan ratio (uQ/T) as an indicator of reduced QPRT. Elevated uQ/T predicted AKI and other adverse outcomes in critically ill patients. A phase 1 placebo-controlled study of oral NAM demonstrated a dose-related increase in circulating NAD+ metabolites. NAM was well tolerated and was associated with less AKI. Therefore, impaired NAD+ biosynthesis may be a feature of high-risk hospitalizations for which NAD+ augmentation could be beneficial.ViewShow abstractSemisynthetic biosensors for mapping cellular concentrations of nicotinamide adenine dinucleotidesArticleFull-text availableMay 2018eLife Olivier Sallin Luc ReymondCorentin GondrandKai JohnssonWe introduce a new class of semisynthetic fluorescent biosensors for the quantification of free nicotinamide adenine dinucleotide (NAD+) and ratios of reduced to oxidized nicotinamide adenine dinucleotide phosphate (NADPH/NADP+) in live cells. Sensing is based on controlling the spatial proximity of two synthetic fluorophores by binding of NAD(P) to the protein component of the sensor. The sensors possess a large dynamic range, can be excited at long wavelengths, are pH-insensitive, have tunable response range and can be localized in different organelles. Ratios of free NADPH/NADP+ are found to be higher in mitochondria compared to those found in the nucleus and the cytosol. By recording free NADPH/NADP+ ratios in response to changes in environmental conditions, we observe how cells can react to such changes by adapting metabolic fluxes. Finally, we demonstrate how a comparison of the effect of drugs on cellular NAD(P) levels can be used to probe mechanisms of action.ViewShow abstractCognitive impairment, clinical severity and MRI changes in MELAS syndromeArticleFull-text availableDec 2017MITOCHONDRION Torsten KrayaLena Neumann Yvonne Paelecke Stefan WatzkeObjective: To examine clinical severity, cognitive impairment, and MRI changes in patients with MELAS syndrome.Methods: Cognitive-mnestic functions, brain MRI (lesion load, cella media index) and clinical severity of ten patients with MELAS syndrome were examined. All patients carried the m.3243A G mutation.Results: The detailed neuropsychological assessment revealed cognitive deficits in attention, executive function, visuoperception, and -construction. There were significant correlations between these cognitive changes, lesion load in MRI, disturbances in everyday life (clinical scale), and high scores in NMDAS.Conclusion: Patients with MELAS syndrome showed no global neuropsychological deficit, but rather distinct cognitive deficits.ViewShow abstractNAD + in Aging: Molecular Mechanisms and Translational ImplicationsArticleFull-text availableSep 2017TRENDS MOL MED Evandro Fei Fang Sofie Lautrup Yujun Hou Vilhelm A BohrThe coenzyme NAD(+) is critical in cellular bioenergetics and adaptive stress responses. Its depletion has emerged as a fundamental feature of aging that may predispose to a wide range of chronic diseases. Maintenance of NAD(+) levels is important for cells with high energy demands and for proficient neuronal function. NAD(+) depletion is detected in major neurodegenerative diseases, such as Alzheimer s and Parkinson s diseases, cardiovascular disease and muscle atrophy. Emerging evidence suggests that NAD(+) decrements occur in various tissues during aging, and that physiological and pharmacological interventions bolstering cellular NAD(+) levels might retard aspects of aging and forestall some age-related diseases. Here, we discuss aspects of NAD(+) biosynthesis, together with putative mechanisms of NAD(+) action against aging, including recent preclinical and clinical trials.ViewShow abstractMetabolic regulation of transcription through compartmentalized NAD + biosynthesisArticleMay 2018SCIENCE Keun Woo Ryu Tulip Sunil Nandu Jiyeon KimW Lee KrausNAD⁺ (nicotinamide adenine dinucleotide in its oxidized state) is an essential molecule for a variety of physiological processes. It is synthesized in distinct subcellular compartments by three different synthases (NMNAT-1, -2, and -3). We found that compartmentalized NAD⁺ synthesis by NMNATs integrates glucose metabolism and adipogenic transcription during adipocyte differentiation. Adipogenic signaling rapidly induces cytoplasmic NMNAT-2, which competes with nuclear NMNAT-1 for the common substrate, nicotinamide mononucleotide, leading to a precipitous reduction in nuclear NAD⁺ levels. This inhibits the catalytic activity of poly[adenosine diphosphate (ADP)–ribose] polymerase–1 (PARP-1), a NAD⁺-dependent enzyme that represses adipogenic transcription by ADP-ribosylating the adipogenic transcription factor C/EBPβ. Reversal of PARP-1–mediated repression by NMNAT-2–mediated nuclear NAD⁺ depletion in response to adipogenic signals drives adipogenesis. Thus, compartmentalized NAD⁺ synthesis functions as an integrator of cellular metabolism and signal-dependent transcriptional programs.ViewShow abstractTherapeutic Potential of NAD-Boosting Molecules: The In Vivo EvidenceArticleMar 2018 Luis RajmanKarolina Chwalek David A SinclairNicotinamide adenine dinucleotide (NAD), the cell s hydrogen carrier for redox enzymes, is well known for its role in redox reactions. More recently, it has emerged as a signaling molecule. By modulating NAD+-sensing enzymes, NAD+controls hundreds of key processes from energy metabolism to cell survival, rising and falling depending on food intake, exercise, and the time of day. NAD+levels steadily decline with age, resulting in altered metabolism and increased disease susceptibility. Restoration of NAD+levels in old or diseased animals can promote health and extend lifespan, prompting a search for safe and efficacious NAD-boosting molecules that hold the promise of increasing the body s resilience, not just to one disease, but to many, thereby extending healthy human lifespan.ViewShow abstractNicotinamide Improves Aspects of Healthspan, but Not Lifespan, in MiceArticleMar 2018CELL METAB Sarah Mitchell Michel Bernier Miguel A Aon Rafael de CaboThe role in longevity and healthspan of nicotinamide (NAM), the physiological precursor of NAD+, is elusive. Here, we report that chronic NAM supplementation improves healthspan measures in mice without extending lifespan. Untargeted metabolite profiling of the liver and metabolic flux analysis of liver-derived cells revealed NAM-mediated improvement in glucose homeostasis in mice on a high-fat diet (HFD) that was associated with reduced hepatic steatosis and inflammation concomitant with increased glycogen deposition and flux through the pentose phosphate and glycolytic pathways. Targeted NAD metabolome analysis in liver revealed depressed expression of NAM salvage in NAM-treated mice, an effect counteracted by higher expression of de novo NAD biosynthetic enzymes. Although neither hepatic NAD+nor NADP+was boosted by NAM, acetylation of some SIRT1 targets was enhanced by NAM supplementation in a diet- and NAM dose-dependent manner. Collectively, our results show health improvement in NAM-supplemented HFD-fed mice in the absence of survival effects.ViewShow abstractNAD + Intermediates: The Biology and Therapeutic Potential of NMN and NRArticleDec 2017CELL METAB Jun Yoshino Joseph A BaurShin-ichiro ImaiResearch on the biology of NAD+ has been gaining momentum, providing many critical insights into the pathogenesis of age-associated functional decline and diseases. In particular, two key NAD+ intermediates, nicotinamide riboside (NR) and nicotinamide mononucleotide (NMN), have been extensively studied over the past several years. Supplementing these NAD+ intermediates has shown preventive and therapeutic effects, ameliorating age-associated pathophysiologies and disease conditions. Although the pharmacokinetics and metabolic fates of NMN and NR are still under intensive investigation, these NAD+ intermediates can exhibit distinct behavior, and their fates appear to depend on the tissue distribution and expression levels of NAD+ biosynthetic enzymes, nucleotidases, and presumptive transporters for each. A comprehensive concept that connects NAD+ metabolism to the control of aging and longevity in mammals has been proposed, and the stage is now set to test whether these exciting preclinical results can be translated to improve human health.ViewShow abstractShow moreAdvertisementRecommendationsDiscover moreProjectGenetically encoded sensors of metabolism Yi Yang Yuzheng Zhao Joseph Loscalzo[...] Jianhua xuWe are currently developing protein based sensors by fusion of fluorescent proteins and specific sensing domains. These sensors may be used conveniently for monitoring various intracellular events. Particularly, we have recently obtained highly responsive NADH, NADPH, glucose and cAMP sensors for live cell imaging. ... [more]View projectProjectThiol redox homeostatisis Yi Yang Yuzheng Zhao Joseph Loscalzo[...] Wenyun ZhengProtein thiol post translational modifications, including protein S-nitrosation, disulfides, sulfenic acid and vicinal dithiols, play important role in cell homeostatisis and signaling. We are inte rested in developing new fluorescent imaging methods for live cell or in situ detection of protein thiol modifications, mechanism of protein thiol proteome regulation and their implications in cell function, drug screening, and protein production. ... [more]View projectProjectBiotechnology Xianjun Chen Yuzheng Zhao Joseph Loscalzo[...] Xie XinView projectArticleFull-text availableAnalysis of redox landscapes and dynamics in living cells and in vivo using genetically encoded fluo...September 2018 · Nature ProtocolsYejun Zou Aoxue WangMei Shi[...] Yuzheng ZhaoCellular oxidation-reduction reactions are mainly regulated by pyridine nucleotides (NADPH/NADP+ and NADH/NAD+), thiols, and reactive oxygen species (ROS) and play central roles in cell metabolism, cellular signaling, and cell-fate decisions. A comprehensive evaluation or multiplex analysis of redox landscapes and dynamics in intact living cells is important for interrogating cell functions in ... [Show full abstract] both healthy and disease states; however, until recently, this goal has been limited by the lack of a complete set of redox sensors. We recently reported the development of a series of highly responsive, genetically encoded fluorescent sensors for NADPH that substantially strengthen the existing toolset of genetically encoded sensors for thiols, H2O2, and NADH redox states. By combining sensors with unique spectral properties and specific subcellular targeting domains, our approach allows simultaneous imaging of up to four different sensors. In this protocol, we first describe strategies for multiplex fluorescence imaging of these sensors in single cells; then we demonstrate how to apply these sensors to study changes in redox landscapes during the cell cycle, after macrophage activation, and in living zebrafish. This approach can be adapted to different genetically encoded fluorescent sensors and various analytical platforms such as fluorescence microscopy, high-content imaging systems, flow cytometry, and microplate readers. A typical preparation of cells or zebrafish expressing different sensors takes 2-3 d; microscopy imaging or flow-cytometry analysis can be performed within 5-60 min.View full-textArticleFull-text availableGenetically encoded fluorescent sensors reveal dynamic regulation of NADPH metabolismJune 2017 · Nature Methods Yuzheng Zhao Yi Yang Tao Rongkun[...]Huanyu ChuReduced nicotinamide adenine dinucleotide phosphate (NADPH) is essential for biosynthetic reactions and antioxidant functions; however, detection of NADPH metabolism in living cells remains technically challenging. We develop and characterize ratiometric, pH-resistant, genetically encoded fluorescent indicators for NADPH (iNap sensors) with various affinities and wide dynamic range. iNap sensors ... [Show full abstract] enabled quantification of cytosolic and mitochondrial NADPH pools that are controlled by cytosolic NAD(+) kinase levels and revealed cellular NADPH dynamics under oxidative stress depending on glucose availability. We found that mammalian cells have a strong tendency to maintain physiological NADPH homeostasis, which is regulated by glucose-6-phosphate dehydrogenase and AMP kinase. Moreover, using the iNap sensors we monitor NADPH fluctuations during the activation of macrophage cells or wound response in vivo. These data demonstrate that the iNap sensors will be valuable tools for monitoring NADPH dynamics in live cells and gaining new insights into cell metabolism.View full-textArticleVisualization of Nicotine Adenine Dinucleotide Redox Homeostasis with Genetically Encoded Fluorescen...June 2017 · Antioxidants and Redox SignalingYejun Zou Yi YangYuzheng ZhaoZhuo ZhangSignificance: Beyond their roles as redox currency in living organisms, pyridine dinucleotides (NAD+/NADH and NADP+/NADPH) are also precursors or co-substrates of great significance in various physiologic and pathologic processes. Recent Advances: For many years, it was challenging to develop methodologies for monitoring pyridine dinucleotides in situ or in vivo. Recent advances in fluorescent ... [Show full abstract] protein-based sensors provide a rapid, sensitive, specific, and real-time read-out of pyridine dinucleotide dynamics in single cells or in vivo, thereby opening a new era of pyridine dinucleotide bioimaging. In this paper, we summarize the developments in genetically encoded fluorescent sensors for NAD+/NADH and NADP+/NADPH redox states, as well as their applications in life sciences and drug discovery. The strengths and weaknesses of individual sensors are also discussed.Critical issues: These sensors have the advantages of being specific and organelle targetable, enabling the real-time monitoring and subcellular-level quantification of targeted molecules in living cells and in vivo.Future directions: NAD+/NADH and NADP+/NADPH have distinct functions in metabolic and redox regulation, thus, a comprehensive evaluation of metabolic and redox states must be multiplexed with a combination of various metabolite sensors in a single cell.Read moreArticleFull-text availableMonitoring intracellular redox metabolism with genetically encoded fluorescent sensorsMay 2017 · Scientia Sinica Vitae Yi YangYuzheng ZhaoZhuo ZhangIn-situ measurement of intracellular redox metabolism with high spatiotemporal resolution remains to be an obstacle in life science research. However, traditional methods including enzymatic assays, chromatography and mass spectrometry require cell lysis, therefore suffer from some defects in real-time detection of redox metabolism in living cells and are not suitable for high-throughput screen. ... [Show full abstract] Recently fluorescent imaging has become a powerful tool for biomedical research with the development of various genetically encoded fluorescent sensors as well as chemical probes. These approachesallow us to dynamically monitor biological processes in living cells, and have made revolutionary changes in life science research. Comparing with chemical probes, genetically encoded fluorescent sensors possess many advantages, including precise subcellular localization, minor artificial disturbance and high suitability for in vivo study. In the past decade, different types of genetically encoded fluorescent sensors have been developed to monitor redox metabolites, enabling imaging redox states at single-cell or sub-cellular resolution as well as in vivo and achieving exciting progresses in theresearch fiel d of redox biology. In this review, taking NADH/NAD + and NADPH/NADP + biosensors for example, we will give a detailed description on the design, property, application and practical concerns of genetically encoded fluorescent sensors to better understand and apply these tools.View full-textArticleIn vivo monitoring of cellular energy metabolism using SoNar, a highly responsive sensor for NAD+/NA...June 2016 · Nature Protocols Yuzheng Zhao Aoxue WangYejun Zou[...] Yi YangNADH and its oxidized form NAD(+) have a central role in energy metabolism, and their concentrations are often considered to be among the most important readouts of metabolic state. Here, we present a detailed protocol to image and monitor NAD(+)/NADH redox state in living cells and in vivo using a highly responsive, genetically encoded fluorescent sensor known as SoNar (sensor of NAD(H) redox). ... [Show full abstract] The chimeric SoNar protein was initially developed by inserting circularly permuted yellow fluorescent protein (cpYFP) into the NADH-binding domain of Rex protein from Thermus aquaticus (T-Rex). It functions by binding to either NAD(+) or NADH, thus inducing protein conformational changes that affect its fluorescent properties. We first describe steps for how to establish SoNar-expressing cells, and then discuss how to use the system to quantify the intracellular redox state. This approach is sensitive, accurate, simple and able to report subtle perturbations of various pathways of energy metabolism in real time. We also detail the application of SoNar to high-throughput chemical screening of candidate compounds targeting cell metabolism in a microplate-reader-based assay, along with in vivo fluorescence imaging of tumor xenografts expressing SoNar in mice. Typically, the approximate time frame for fluorescence imaging of SoNar is 30 min for living cells and 60 min for living mice. For high-throughput chemical screening in a 384-well-plate assay, the whole procedure generally takes no longer than 60 min to assess the effects of 380 compounds on cell metabolism.Read moreDiscover the world s researchJoin ResearchGate to find the people and research you need to help your work.Join for free ResearchGate iOS AppGet it from the App Store now.InstallKeep up with your stats and moreAccess scientific knowledge from anywhere orDiscover by subject areaRecruit researchersJoin for freeLoginEmail Tip: Most researchers use their institutional email address as their ResearchGate loginPasswordForgot password? Keep me logged inLog inorContinue with GoogleWelcome back! Please log in.Email · HintTip: Most researchers use their institutional email address as their ResearchGate loginPasswordForgot password? Keep me logged inLog inorContinue with GoogleNo account? Sign upCompanyAbout usNewsCareersSupportHelp CenterBusiness solutionsAdvertisingRecruiting© 2008-2021 ResearchGate GmbH. All rights reserved.TermsPrivacyCopyrightImprint